Outpost Universe Forums

Off Topic => Test/Spam Forum => Forum Games => Topic started by: Leviathan on March 22, 2005, 12:46:12 PM

Title: The Bumpy Thread
Post by: Leviathan on March 22, 2005, 12:46:12 PM
:huh:

Rules:

    * Your post MUST have bump in it
    * You may not bump twice in a row
    * It doesn't matter how you bump, so long as you bump

/me bumps

<_<  
Title: The Bumpy Thread
Post by: Saibot on March 22, 2005, 02:49:14 PM
No, my bumps are not here! Where are them! No!

Welcome new bump-thread.
Title: The Bumpy Thread
Post by: Leviathan on March 22, 2005, 03:03:07 PM
omg

he bumped!
Title: The Bumpy Thread
Post by: Saibot on March 23, 2005, 06:18:39 AM
6275 6D70 on you![/i]bump
Title: The Bumpy Thread
Post by: zigzagjoe on March 23, 2005, 07:35:33 AM
bumpitty bump-bump
Title: The Bumpy Thread
Post by: Saibot on March 23, 2005, 07:45:28 AM
This can't be true: http://computersweden.idg.se/ArticlePages/...2_CS984.dbp.asp (http://computersweden.idg.se/ArticlePages/200503/23/20050323113102_CS984/20050323113102_CS984.dbp.asp)
I let the link spoke for it self... oh I forgott that not many can swedish...

It says that soon, the cabel network can go from 8 Mb/s to 640 Mb/s.
bump
That's 80 times faster. I can not belew it!
Title: The Bumpy Thread
Post by: Eddy-B on March 23, 2005, 09:20:35 AM
i don't like BUMPs.. well not entirely true:  speed-bumps are cool .. if they're not too high - and if you're alone on the road, not with a snail in front of you that tends to slow down to 1kph just to take the bump .. i hate that.

 
Title: The Bumpy Thread
Post by: CK9 on March 23, 2005, 06:34:08 PM
bump
Title: The Bumpy Thread
Post by: coolzero on March 24, 2005, 10:51:46 AM
why do we BUMP ??? some ppl should HUMP
Title: The Bumpy Thread
Post by: Saibot on March 24, 2005, 04:45:26 PM
¿HUMP to BUMP for HUMP?
Title: The Bumpy Thread
Post by: Saibot on March 25, 2005, 10:08:26 AM
This new standard layout is worse then the last one. I miss the space! Give it back to us!
Bump
Title: The Bumpy Thread
Post by: Eddy-B on March 25, 2005, 11:06:27 AM
You need to select a new skin !

BUMP
Title: The Bumpy Thread
Post by: Leviathan on March 25, 2005, 11:10:50 AM
bump

i dont like the default skin, so i dont use it
Title: The Bumpy Thread
Post by: zigzagjoe on March 25, 2005, 11:29:33 AM
爆沸
buil
bosse
Stoß
πρόσκρουση
urto
隆起
융기
colisão
ремуо
topetón
bump
 
Title: The Bumpy Thread
Post by: Leviathan on March 25, 2005, 11:58:00 AM
nice bump..
bump
Title: The Bumpy Thread
Post by: plymoth45 on March 25, 2005, 01:23:44 PM
may as well bump
Title: The Bumpy Thread
Post by: Betaray on March 28, 2005, 10:43:02 PM
well, lets see how long it takes us to make 100 pages of bumps

starting........

BUMP
Title: The Bumpy Thread
Post by: Mez on March 29, 2005, 04:31:03 AM
bump
 
Title: The Bumpy Thread
Post by: plymoth45 on March 29, 2005, 07:35:12 AM
bump
 
Title: The Bumpy Thread
Post by: Saibot on March 29, 2005, 09:48:41 AM
bump [bad data].
Title: The Bumpy Thread
Post by: Leviathan on March 29, 2005, 04:03:55 PM
bumppppppppppppppp
Title: The Bumpy Thread
Post by: plymoth45 on March 29, 2005, 04:14:35 PM
Lev, you used to not bump much.
Title: The Bumpy Thread
Post by: CK9 on March 29, 2005, 04:24:09 PM
since I'm no longer a GM, I don't have any need to set an example anymore.  You all (or at least those who were at kiler's forum) know what that means!

SMILEY SPAM!!!! bump style:



  (xp)  :Cool:  (thumbsup)  (thumbsdown)  [OT]  :Luweeg:  :plymoth:  :stop:  :bump:  :anibump:


edit (3/21/2011): For those who were not here, this post was during a bit of a controversial point in the community history.  Please do not immitate this post :P
Title: The Bumpy Thread
Post by: plymoth45 on March 29, 2005, 05:36:53 PM
lol, now you guys have gone and done it.
Title: The Bumpy Thread
Post by: CK9 on March 29, 2005, 07:22:35 PM
heh, looks like lev made a mistake in tanslating something I said.

forumite-smiley bump:

 :CK9's:  :x:  :Betaray:  :Luweeg:  :plymoth:  :hack:

and one that was once synonomous with betaray:   :spam:  
Title: The Bumpy Thread
Post by: plymoth45 on March 29, 2005, 08:05:02 PM
well, this forumite is too lazy to make a smiley bump :P
Title: The Bumpy Thread
Post by: CK9 on March 30, 2005, 09:13:52 AM
But what about YOUR smiley?  bump
Title: The Bumpy Thread
Post by: plymoth45 on March 30, 2005, 10:22:02 AM
ooo yes, forgot about that.

PS: Where did my bumping site help thread go?
Title: The Bumpy Thread
Post by: CK9 on March 31, 2005, 09:36:42 AM
when in bump, blame an admin
Title: The Bumpy Thread
Post by: Leviathan on March 31, 2005, 10:37:19 AM
it went into General Computer Discussion

bump
> bump
Title: The Bumpy Thread
Post by: Saibot on April 01, 2005, 10:18:08 AM
[DoHtml]
<table border=0 cellpadding=0 cellspacing=0 background="html/emoticons/bump2.gif" width=100% height=100>
  <tr>
   <td align=center>
      <center><font color=black>bump</font></center>
   </td>
  </tr>
</table>
[/DoHtml]
Title: The Bumpy Thread
Post by: CK9 on April 01, 2005, 10:32:13 AM
nice ninja bump
Title: The Bumpy Thread
Post by: plymoth45 on April 01, 2005, 09:10:42 PM
bump the GM!
Title: The Bumpy Thread
Post by: Leviathan on April 02, 2005, 04:47:58 AM
bump

i removed the script hacker added to change url into a '.'
but i do agree with him that you shouldnt be posting it, we are a small community and need 2 stay together.

bump
Title: The Bumpy Thread
Post by: Kiith Somtaaw on April 02, 2005, 12:45:50 PM


Rage   >:(
Title: The Bumpy Thread
Post by: zigzagjoe on April 02, 2005, 01:11:01 PM
bump bump

i see levi and Kiith has broken de rulz....
Title: The Bumpy Thread
Post by: Mez on April 02, 2005, 01:50:27 PM
budump
Title: The Bumpy Thread
Post by: CK9 on April 03, 2005, 09:19:59 AM
bump

mn
.x.

^
take a wild guess
Title: The Bumpy Thread
Post by: plymoth45 on April 03, 2005, 09:47:26 AM
no bumping clue
Title: The Bumpy Thread
Post by: CK9 on April 03, 2005, 12:07:30 PM
bump cookie to the first to figure it out :P
Title: The Bumpy Thread
Post by: Duo on April 06, 2005, 08:45:46 AM
long time no see bump!
Title: The Bumpy Thread
Post by: Saibot on April 06, 2005, 01:41:08 PM
Bump with suicide in progress:


EDIT (leeor_net): fixing bb code
Title: The Bumpy Thread
Post by: CK9 on April 06, 2005, 03:08:14 PM
bump
Title: The Bumpy Thread
Post by: Leviathan on April 06, 2005, 04:09:22 PM
OMFG HEY Duo :D

i cant stop but

bump!
Title: The Bumpy Thread
Post by: CK9 on April 06, 2005, 05:31:53 PM
bum





































































p
Title: The Bumpy Thread
Post by: Betaray on April 06, 2005, 08:15:13 PM
squirly bump
Title: The Bumpy Thread
Post by: jesusfreak06 on April 07, 2005, 06:00:42 AM
nice CK9.. u've been bump                                                          














t  
Title: The Bumpy Thread
Post by: Saibot on April 07, 2005, 06:35:24 AM
Bump


EDIT (leeor_net): fixing tags
Title: The Bumpy Thread
Post by: CK9 on April 07, 2005, 08:41:15 AM
b ran u dom m ness p
Title: The Bumpy Thread
Post by: Saibot on April 08, 2005, 04:58:23 AM

Code: [Select]
<i>Verson 2</i>
<br>
<input id="n" type="text" name="n" value="Password" onFocus="if(this.value=='Password')this.value=''" onblur="if(this.value=='bump'){this.value='Access granted!'; write('<span style=z-index:0;position:relative;left:0;top:0><span style=z-index:0;position:absolute;left:0;top:0><span style=position:absolute;z-index:1><marquee behavior=alternate direction=left width=320 height=240 scrollamount=20><marquee behavior=alternate direction=up width=120 height=320 scrollamount=1><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:2><marquee behavior=alternate direction=left width=320 height=240 scrollamount=19><marquee behavior=alternate direction=up width=120 height=320 scrollamount=2><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:3><marquee behavior=alternate direction=left width=320 height=240 scrollamount=18><marquee behavior=alternate direction=up width=120 height=320 scrollamount=3><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:4><marquee behavior=alternate direction=left width=320 height=240 scrollamount=17><marquee behavior=alternate direction=up width=120 height=320 scrollamount=4><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:5><marquee behavior=alternate direction=left width=320 height=240 scrollamount=16><marquee behavior=alternate direction=up width=120 height=320 scrollamount=5><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:6><marquee behavior=alternate direction=left width=320 height=240 scrollamount=15><marquee behavior=alternate direction=up width=120 height=320 scrollamount=6><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:7><marquee behavior=alternate direction=left width=320 height=240 scrollamount=14><marquee behavior=alternate direction=up width=120 height=320 scrollamount=7><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:8><marquee behavior=alternate direction=left width=320 height=240 scrollamount=13><marquee behavior=alternate direction=up width=120 height=320 scrollamount=8><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:9><marquee behavior=alternate direction=left width=320 height=240 scrollamount=12><marquee behavior=alternate direction=up width=120 height=320 scrollamount=9><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:10><marquee behavior=alternate direction=left width=320 height=240 scrollamount=11><marquee behavior=alternate direction=up width=120 height=320 scrollamount=10><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:11><marquee behavior=alternate direction=left width=320 height=240 scrollamount=10><marquee behavior=alternate direction=up width=120 height=320 scrollamount=11><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:12><marquee behavior=alternate direction=left width=320 height=240 scrollamount=9><marquee behavior=alternate direction=up width=120 height=320 scrollamount=12><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:13><marquee behavior=alternate direction=left width=320 height=240 scrollamount=8><marquee behavior=alternate direction=up width=120 height=320 scrollamount=13><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:14><marquee behavior=alternate direction=left width=320 height=240 scrollamount=7><marquee behavior=alternate direction=up width=120 height=320 scrollamount=14><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:15><marquee behavior=alternate direction=left width=320 height=240 scrollamount=6><marquee behavior=alternate direction=up width=120 height=320 scrollamount=15><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:16><marquee behavior=alternate direction=left width=320 height=240 scrollamount=5><marquee behavior=alternate direction=up width=120 height=320 scrollamount=16><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:17><marquee behavior=alternate direction=left width=320 height=240 scrollamount=4><marquee behavior=alternate direction=up width=120 height=320 scrollamount=17><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:18><marquee behavior=alternate direction=left width=320 height=240 scrollamount=3><marquee behavior=alternate direction=up width=120 height=320 scrollamount=18><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:19><marquee behavior=alternate direction=left width=320 height=240 scrollamount=2><marquee behavior=alternate direction=up width=120 height=320 scrollamount=19><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:20><marquee behavior=alternate direction=left width=320 height=240 scrollamount=1><marquee behavior=alternate direction=up width=120 height=320 scrollamount=20><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span></span></span>')} else{write('dumbass')}" onmousemove="if(this.value=='Access denay!')this.value='Password'">

Guese the bumping password and click somewhere outside the box.



EDIT (leeor_net): HTML not allowed in posts
Title: The Bumpy Thread
Post by: CK9 on April 08, 2005, 07:58:59 AM
that was bumping easy...
Title: The Bumpy Thread
Post by: Saibot on April 09, 2005, 04:07:17 AM
Come on, this is a bump thread...
Title: The Bumpy Thread
Post by: Betaray on April 09, 2005, 08:25:04 AM
bump bump bump boo!!
Title: The Bumpy Thread
Post by: zigzagjoe on April 09, 2005, 11:04:59 AM
/me bumps betaray with a cattle prod
Title: The Bumpy Thread
Post by: CK9 on April 09, 2005, 11:33:51 AM
bump
Title: The Bumpy Thread
Post by: Betaray on April 09, 2005, 12:50:48 PM
me gets electrical bump
Title: The Bumpy Thread
Post by: CK9 on April 10, 2005, 10:28:46 AM
/me tosses bump water on beta
Title: The Bumpy Thread
Post by: Betaray on April 10, 2005, 10:49:45 AM
/me gets bumping wet
Title: The Bumpy Thread
Post by: Saibot on April 12, 2005, 12:39:02 PM
A classic by me; The bump man:
[DoHtml]
<marquee direction=right behavior=alternate width=100% bgcolor=#000000>

   <font color=brown>___</font>
  <font color="999944">{</font><font color=blue>õ</font><font color=darkred>¡</font><font color=blue>õ</font><font color="999944">}</font>
<font color=darkgreen>_</font><font color=#aaff00>_</font><font color=yellow>_</font><font color="999944">|¤|</font><font color=yellow>_</font><font color=#aaff00>_</font><font color=darkgreen>_</font>
<font color=darkgreen>| |</font><font color=#ffff00>|||</font><font color=darkgreen>| |</font>
<font color=darkgreen>| |</font><font color=#ffff00>|||</font><font color=darkgreen>| |</font>
<font color=darkgreen>|~|</font><font color=#ffff00>|</font><font color="999944">.<font color=#ffff00>|</font><font color=darkgreen>|~|</font>
 <font color="999944">®</font> ||| <font color="999944">®</font></font>
  <font color=blue>/</font> <font color=metalic>&</font> <font color=blue>\</font>
 <font color=blue>| | | |</font>
 <font color=lighblue>{</font><font color="999944">©</font><font color=lighblue>}</font> <font color=lighblue>{</font><font color="999944">©</font><font color=lighblue>}</font>
 <font color=blue>|~| |~|</font>
  <font color="999944">#</font>   <font color="999944">#</font>

</marquee>
</marquee>
[/DoHtml]
Title: The Bumpy Thread
Post by: Betaray on April 12, 2005, 03:41:04 PM
nice bump
Title: The Bumpy Thread
Post by: Mez on April 13, 2005, 05:48:29 AM
bump
Title: The Bumpy Thread
Post by: CK9 on April 13, 2005, 06:51:00 AM
no bump pong yet?
Title: The Bumpy Thread
Post by: Saibot on April 15, 2005, 08:02:16 AM
Bump = dead?
Title: The Bumpy Thread
Post by: Betaray on April 15, 2005, 12:28:51 PM
bump+yum
Title: The Bumpy Thread
Post by: Leviathan on April 15, 2005, 12:30:46 PM
bumppp
bump pong??
bump bounce bump?
Title: The Bumpy Thread
Post by: CK9 on April 15, 2005, 03:33:24 PM
bump beta!
Title: The Bumpy Thread
Post by: Betaray on April 16, 2005, 10:08:06 PM
bump Ck9 on DVD!!!
Title: The Bumpy Thread
Post by: it2000us on April 16, 2005, 10:35:36 PM
This is a bumping stupid thread. :P  
Title: The Bumpy Thread
Post by: Betaray on April 16, 2005, 11:22:43 PM
thats the bumping point!!
Title: The Bumpy Thread
Post by: Mez on April 17, 2005, 12:23:35 PM
most bumping definatly
Title: The Bumpy Thread
Post by: CK9 on April 18, 2005, 04:02:49 PM
bump blood!
Title: The Bumpy Thread
Post by: Sl0vi on April 18, 2005, 04:12:03 PM
B
U
M
P
!
Title: The Bumpy Thread
Post by: CK9 on April 18, 2005, 06:27:49 PM
bump
Title: The Bumpy Thread
Post by: Saibot on April 19, 2005, 02:00:47 PM
boring bump
Title: The Bumpy Thread
Post by: CK9 on April 20, 2005, 06:42:03 AM
duct tape bump
Title: The Bumpy Thread
Post by: plymoth45 on April 21, 2005, 12:04:32 AM
music bump
Title: The Bumpy Thread
Post by: CK9 on April 21, 2005, 06:53:07 PM
Minor Threat bump
Title: The Bumpy Thread
Post by: Leviathan on April 21, 2005, 07:00:32 PM
uber bump
Title: The Bumpy Thread
Post by: Saibot on April 22, 2005, 08:39:54 AM
bump
(http://ftp://213.89.179.233/Bump.gif)
Title: The Bumpy Thread
Post by: Sl0vi on April 22, 2005, 12:04:09 PM
just another bump
Title: The Bumpy Thread
Post by: CK9 on April 22, 2005, 05:52:48 PM
/\/\/\/\/\
<bump>
\/\/\/\/\/

^horney bump lol
Title: The Bumpy Thread
Post by: plymoth45 on April 22, 2005, 09:11:13 PM
duetch bump (If onyl i new the German word for bump)
Title: The Bumpy Thread
Post by: CK9 on April 24, 2005, 08:11:52 AM
to answer your semi-question plym, Beule
Title: The Bumpy Thread
Post by: plymoth45 on April 24, 2005, 09:31:39 AM
ahh, i see, Beule lol.
Title: The Bumpy Thread
Post by: CK9 on April 25, 2005, 06:21:00 AM
Beule :D
Title: The Bumpy Thread
Post by: plymoth45 on April 25, 2005, 08:08:35 PM
Ich Versetehe Buele (How ever you spell Understand :P)
Title: The Bumpy Thread
Post by: CK9 on April 26, 2005, 08:15:27 AM
bump
Title: The Bumpy Thread
Post by: Saibot on April 26, 2005, 11:27:12 AM
[dohtml]<center>Remember this bump:</center>
<marquee direction="up" align="center" bgcolor="black" border="0" scrollamount="10" scrolldelay="0" title="Ski" bgcolor=#000000>
<hr width="1">
<hr width="2">
<hr width="3">
<hr width="4">
<hr width="5">
<hr width="6">
<hr width="7">
<hr width="8">
<hr width="9">
<hr width="10">
<hr width="11">
<hr width="12">
<hr width="13">
<hr width="14">
<hr width="15">
<hr width="16">
<hr width="17">
<hr width="18">
<hr width="19">
<hr width="20">
<hr width="21">
<hr width="22">
<hr width="21">
<hr width="23">
<hr width="24">
<hr width="25">
<hr width="26">
<hr width="27">
<hr width="28">
<hr width="29">
<hr width="30">
<hr width="31">
<hr width="32">
<hr width="33">
<hr width="34">
<hr width="35">
<hr width="36">
<hr width="37">
<hr width="38">
<hr width="39">
<hr width="40">
<hr width="41">
<hr width="42">
<hr width="43">
<hr width="44">
<hr width="45">
<hr width="46">
<hr width="47">
<hr width="48">
<hr width="49">
<hr width="50">
<hr width="51">
<hr width="52">
<hr width="53">
<hr width="54">
<hr width="55">
<hr width="56">
<hr width="57">
<hr width="58">
<hr width="59">
<hr width="60">
<hr width="61">
<hr width="62">
<hr width="63">
<hr width="64">
<hr width="65">
<hr width="66">
<hr width="67">
<hr width="68">
<hr width="69">
<hr width="70">
<hr width="71">
<hr width="72">
<hr width="73">
<hr width="74">
<hr width="75">
<hr width="76">
<hr width="77">
<hr width="78">
<hr width="79">
<hr width="80">
<hr width="81">
<hr width="82">
<hr width="83">
<hr width="84">
<hr width="85">
<hr width="86">
<hr width="87">
<hr width="88">
<hr width="89">
<hr width="90">
<hr width="91">
<hr width="92">
<hr width="93">
<hr width="94">
<hr width="95">
<hr width="96">
<hr width="97">
<hr width="98">
<hr width="99">
<hr width="100">
<hr width="102">
<hr width="104">
<hr width="106">
<hr width="108">
<hr width="110">
<hr width="112">
<hr width="114">
<hr width="116">
<hr width="118">
<hr width="120">
<hr width="122">
<hr width="124">
<hr width="126">
<hr width="128">
<hr width="130">
<hr width="132">
<hr width="134">
<hr width="136">
<hr width="138">
<hr width="140">
<hr width="142">
<hr width="144">
<hr width="146">
<hr width="148">
<hr width="150">
<hr width="152">
<hr width="154">
<hr width="156">
<hr width="158">
<hr width="160">
<hr width="162">
<hr width="164">
<hr width="166">
<hr width="168">
<hr width="170">
<hr width="172">
<hr width="174">
<hr width="176">
<hr width="178">
<hr width="180">
<hr width="182">
<hr width="184">
<hr width="186">
<hr width="188">
<hr width="190">
<hr width="192">
<hr width="194">
<hr width="196">
<hr width="198">
<hr width="200">
<hr width="204">
<hr width="208">
<hr width="212">
<hr width="216">
<hr width="220">
<hr width="224">
<hr width="228">
<hr width="232">
<hr width="236">
<hr width="240">
<hr width="244">
<hr width="248">
<hr width="252">
<hr width="256">
<hr width="260">
<hr width="264">
<hr width="268">
<hr width="272">
<hr width="276">
<hr width="280">
<hr width="284">
<hr width="288">
<hr width="292">
<hr width="296">
<hr width="300">
<hr width="308">
<hr width="316">
<hr width="324">
<hr width="332">
<hr width="340">
<hr width="348">
<hr width="356">
<hr width="364">
<hr width="372">
<hr width="380">
<hr width="388">
<hr width="394">
<hr width="402">
<hr width="418">
<hr width="434">
<hr width="450">
<hr width="466">
<hr width="482">
<hr width="498">
<hr width="530">
<hr width="562">
<hr width="594">
<hr width="660">
<hr width="788">
</marquee>
<center>?</center>
[/dohtml]
Title: The Bumpy Thread
Post by: plymoth45 on April 26, 2005, 04:00:00 PM
lets all fall down the bump stairs!
Title: The Bumpy Thread
Post by: Saibot on April 27, 2005, 06:47:06 AM
Code: [Select]
<bgsound src="http://www.nesfiles.com/NES/Lemmings/xkylem.mid">
<table border=0 cellpadding=0 cellspacing=0 bgcolor=#000000 width=100%>
<tr><td>
<p align="left"><font color=#440000>bump</font></p><center>
<table border=0 cellpadding=0 cellspacing=0>
<tr><td>
  <img src="http://exotica.fix.no/gallery/games/images/l/Lemmings.jpg" alt="Lemmings">
</tr></td>
</table></center>
<p align="right"><font color=#000044>bump</font></p>
</tr></td>
</table>


EDIT (leeor_net): HTML not allowed
Title: The Bumpy Thread
Post by: plymoth45 on April 27, 2005, 06:48:21 AM
AHHH! LEMMINGS!! THE HORROR!!

Bump
Title: The Bumpy Thread
Post by: CK9 on April 27, 2005, 07:17:44 AM
you're a bumping luny!
Title: The Bumpy Thread
Post by: Saibot on April 27, 2005, 01:50:32 PM
Code: [Select]
<table border=0 cellpadding=0 cellspacing=0 bgcolor=#000000 width=100%><tr> 
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
</tr></table>


<table border=0 cellpadding=0 cellspacing=0 background="" width=100% height=80px summary="Bumping boobs" Title="Bump righ; Bump left"><tr><td></td></tr></table>


<table border=0 cellpadding=0 cellspacing=0 bgcolor=#000000 width=100%><tr>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
<td width=60>
<marquee behavior=alternate direction=right>bump</marquee></td>
</tr></table>


EDIT (leeor_net): HTML not allowed
Title: The Bumpy Thread
Post by: CK9 on April 27, 2005, 03:22:21 PM
^ saibot's bowels after a bump-sandwhich
Title: The Bumpy Thread
Post by: zhukant on April 27, 2005, 04:09:19 PM
So all we do here is insert the word bump into our conversations?

BBB     U              U    MM          MM    PPPP
B    B   U              U    M  M      M  M    P      P
B     B  U              U    M    M  M    M    P       P
B    B   U              U    M      M      M    P      P
BBB     U              U    M              M    PPPP
B    B   U              U    M              M    P
B     B  U              U    M              M    P
B    B     U          U      M              M    P
BBB         UUUUU        M              M    P
Title: The Bumpy Thread
Post by: Leviathan on April 27, 2005, 04:09:52 PM
if there is nothing else to do: bump

ck9 ur a mod, im prity sure should of deleted that post, no tities here, thx.
Title: The Bumpy Thread
Post by: CK9 on April 28, 2005, 08:28:03 AM
lev, you're bumping confusing me
Title: The Bumpy Thread
Post by: Eddy-B on April 28, 2005, 03:38:50 PM
:bump:
Title: The Bumpy Thread
Post by: plymoth45 on April 28, 2005, 09:10:56 PM
I didn't bumping get to see saibot's post before the edit :(
Title: The Bumpy Thread
Post by: Saibot on May 02, 2005, 11:03:26 AM
This thread have been [DoHtml]<font size=1px>bump</font><font size=50px>†</font><font size=1px>bump</font>[/DoHtml] too long...
Ops: Missed an importent thing...
Title: The Bumpy Thread
Post by: Sl0vi on May 02, 2005, 12:03:55 PM
where was the bump in that ?
Title: The Bumpy Thread
Post by: Phantom on May 02, 2005, 03:05:29 PM
Bump
Title: The Bumpy Thread
Post by: Betaray on May 03, 2005, 09:57:04 AM
bump?
Title: The Bumpy Thread
Post by: Saibot on May 03, 2005, 01:14:59 PM
Bump®
Title: The Bumpy Thread
Post by: Phantom on May 03, 2005, 02:25:36 PM
Bump©
Title: The Bumpy Thread
Post by: Saibot on May 03, 2005, 05:11:11 PM
[DoHtml]<table background="http://forum.outpostuniverse.net/uploads/post-8-1115164616.gif" width=100% height=100><tr><td><center><font color=#00bb00>bump</font></center></tr></td></table>[/DoHtml]
Title: The Bumpy Thread
Post by: Phantom on May 03, 2005, 10:13:24 PM
That's a nice bumpin bump. Almost couldn't find it!
Title: The Bumpy Thread
Post by: Saibot on May 04, 2005, 05:08:50 AM
[DoHtml]
<marquee height=100 color=#008700 bgcolor=#000000 direction=up scrollamount=33>

2277bump30227
8651bump21007
16241bump29553
16109bump21040
29360bump4106
21088bump14175
21199bump30182
28251bump23042
26988bump4031
31744bump17091
4183bump13493
2110bump21478
17813bump15427
22518bump7385
171bump3698
1884bump3085
27929bump1100
14497bump29445
11812bump11412
5583bump4269
4056bump18612
10740bump5612
18766bump5623
21890bump22652
13355bump14072
25078bump10234
7529bump20827
30904bump31033
4954bump13242
322bump23516
21737bump6114
10885bump28196
17956bump21824
9096bump17158
3575bump6038
18259bump28289
16698bump28146
16395bump11310
16111bump17889
25950bump21529
8644bump9952
23074bump4559
27360bump16915
11576bump4536
18907bump10810
439bump6311
9742bump18400
582bump14768
19726bump24021
9162bump7738
27251bump12767
31554bump5204
11486bump11693
10990bump22349
15418bump3084
10935bump18046
25921bump26206
28619bump32363
7746bump13895
14216bump2059
18722bump8105
31131bump4707
22178bump5843
17769bump27226
11999bump14069
3758bump9416
799bump23767
11619bump11984
27850bump22987
5350bump14448
32183bump21217
1621bump11606
9641bump8281
16954bump12277
4378bump16734
32110bump19161
25911bump14321
7479bump19511
32043bump24867
32436bump32713
3232bump7559
19835bump15064
19331bump24039
11648bump28315
3848bump26678
15417bump13503
29679bump26822
11519bump2631
32261bump9147
1208bump11414
20717bump23232
14515bump19658
26144bump15096
13523bump3404
25651bump26423
3312bump32165
31577bump29299
23930bump2196
27432bump24181
8031bump2141
5536bump29396
29487bump30051
17257bump36
10111bump25337
32092bump25451
32395bump15990
8005bump24020
30495bump1159
2023bump5288
7351bump24778
2625bump19833
8933bump27544
1040bump15009
20467bump31266
15765bump27627
31433bump13503
30360bump14223
8210bump26500
17581bump12132
21147bump16662
9910bump30289
2811bump29628
29097bump2564
6777bump27832
31380bump21735
17706bump5592
8670bump7248
18266bump21832
9167bump7929
18989bump16298
21074bump30639
2950bump12392
7162bump6222
15656bump15433
1092bump28908
24348bump12867
28956bump5973
6482bump7825
29090bump696
22667bump1029
25133bump12191
12917bump16286
4496bump16420
21784bump19037
19357bump27746
1394bump19797
27880bump22315
29022bump15362
25550bump6905
22715bump26843
17077bump8998
20937bump18474
18324bump9567
11478bump21788
31927bump20310
15131bump19732
22204bump31927
31969bump13637
29666bump2398
31464bump24192
24707bump5063
20232bump23370
1246bump17349
8217bump7218
8218bump26999
5393bump9826
29832bump2168
876bump6259
2345bump9047
23761bump29062
9328bump23367
8178bump20112
25672bump14359
20660bump4597
5977bump11364
15248bump10585
15239bump10765
2104bump26034
17852bump23271
24446bump6562
5864bump20914
10354bump29189
16966bump18252
8395bump15558
2272bump14373
21641bump4598
11861bump30195
14552bump4895
2778bump423
28214bump13525
32383bump16799
28120bump18063
10676bump26653
9802bump11445
3851bump7672
19287bump250
575bump17809
23848bump3308
2166bump27145
10928bump21193
3523bump11953
21319bump6293
5103bump21186
2964bump10601
15993bump7503
10673bump16654
24539bump17783
15498bump21963
27663bump10975
12934bump13434
29778bump29280
21354bump8929
4136bump23292
4474bump31808
22432bump24343
30177bump31783
21209bump30179
11346bump11146
709bump2333
29168bump9239
26413bump29431
27499bump7623
9717bump6229
9836bump31412
14242bump29499
18996bump17706
15641bump8582
15232bump21504
25257bump19419
14255bump2345
29772bump30942
11046bump24198
1834bump8356
18164bump13566
23647bump5226
6578bump6609
24830bump3719
12205bump30249
28502bump32415
32328bump23795
13684bump26138
7835bump27372
25833bump22740
7008bump27903
4045bump30230
22032bump16590
22275bump28102
18249bump9103
19903bump26074
7795bump25369
13894bump21522
1187bump9534
31733bump8167
1727bump14684
3717bump8383
27364bump10287
653bump19554
29956bump30185
6984bump10673
24276bump19077
8601bump23446
1765bump29784
11340bump22583
6928bump30953
15775bump8303
16920bump10242
23041bump2942
2187bump25863
31769bump31487
5353bump6791
2570bump2843
26376bump3089
12278bump4861
9911bump31305
17345bump2437
17826bump19770
5655bump8769
30838bump14574
21680bump13977
19269bump4156
25042bump20297
21803bump14818
17688bump25109
20274bump31700
6515bump6071
4723bump4307
7278bump11805
16766bump15424
17078bump19153
8444bump20531
30169bump20921
25491bump22984
24398bump5120
27914bump26553
25782bump27476
20654bump7986
14689bump5458
3828bump4832
10516bump25406
22111bump4172
9bump4600
19364bump22375
13368bump24107
7437bump28773
13269bump10440
25883bump5071
32026bump16307
8303bump22740
25414bump7868
15082bump7649
9446bump15568
30740bump24433
14163bump14704
15034bump28965
27516bump32355
28636bump19735
20453bump10664
8390bump28012
29680bump21423
28796bump25640
28764bump1481
2139bump9542
22795bump29916
14334bump14089
31752bump21595
19551bump15501
4552bump21877
25150bump3745
17072bump9869
14279bump22233
9688bump1771
16751bump24798
7439bump17073
1567bump5641
12831bump11024
1684bump22320
22866bump24251
13318bump10432
15668bump30364
14855bump25868
30619bump27335
8111bump26853
23525bump17324
1014bump28267
13953bump27536
31073bump2594
9649bump13374
17633bump32329
28557bump25849
1016bump22631
31052bump25782
32285bump3366
17343bump21640
9570bump1636
4382bump11868
2644bump22408
6151bump15334
18210bump3090
26564bump31195
9730bump17527
25037bump15201
1745bump5419
27789bump8644
18425bump23551
17257bump15466
13976bump32685
2047bump25865
18911bump19889
30891bump11287
11704bump27227
28752bump27010
24747bump1827
4949bump17826
26882bump21308
19949bump20076
25899bump23148
1948bump27880
31583bump17946
12279bump20197
27777bump13481
2219bump6379
20041bump6916
20672bump29809
12449bump25722
13599bump20048
12879bump17613
10834bump22904
18645bump28805
5004bump10721
16277bump12170
23273bump31685
12857bump32242
24310bump31501
1618bump12056
22900bump7945
10303bump18158
9049bump28259
3921bump32148
31256bump16214
19757bump8489
10786bump18459
11377bump18913
17069bump5028
8858bump5207
14004bump11917
6437bump22053
3903bump8272
20980bump179
4836bump1208
27380bump9804
1678bump22936
17661bump21879
27517bump21692
20985bump16004
24206bump22048
3657bump22373
31933bump19040
10596bump29119
28904bump4464
8641bump30529
3798bump15757
22520bump16437
8055bump15987
23844bump14420
17005bump19665
139bump17887
2252bump10746
24705bump9963
11550bump2013
649bump14589
3243bump11575
14014bump24278
17911bump10759
19057bump30864
8331bump12355
19988bump8682
8696bump25801
29270bump10977
29722bump15512
16528bump32384
154bump14912
12896bump27640
26038bump8087
27795bump1523
10309bump26542
8521bump3110
18165bump7427
23891bump4901
4824bump24568
17632bump24188
28959bump12676
857bump8443
27173bump22057
29321bump5969
10671bump25894
15617bump12509
21618bump22509
32699bump15040
22229bump11735
12029bump16695
4345bump30743
17024bump6952
1014bump25069
27858bump21498
25704bump2332
25081bump26538
13867bump15005
29017bump1307
21858bump26517
30424bump19118
4286bump26245
26431bump12563
14589bump21696
31715bump6239
18864bump11299
16774bump11102
3906bump24832
3704bump3370
28214bump7259
9217bump1276
12208bump26201
32516bump7235
30519bump21749
7132bump25331
17849bump4853
12682bump20000
11727bump21276
10258bump25803
7491bump930
20002bump12028
24528bump21985
4597bump6929
16168bump28241
16759bump19797
25660bump20662
5546bump3540
23991bump23704
3400bump18542
28619bump28148
23210bump21291
4401bump30257
26856bump28366
14699bump8533
15426bump13741
25677bump23417
12734bump27839
28347bump19067
25107bump27383
12468bump4082
11206bump2768
30864bump26471
10387bump23082
19333bump29890
4622bump31828
3952bump22274
22922bump29290
466bump21297
30522bump15841
8217bump11159
13462bump4448
25890bump30511
30208bump977
32763bump3415
18344bump31161
26605bump22987
12717bump14532
29114bump11476
6021bump22949
18979bump23485
9886bump3100
31149bump17799
6213bump24920
21925bump4062
19144bump4224
610bump12363
30167bump27021
27338bump5546
32304bump27226
20760bump1503
11388bump10750
23772bump965
19315bump3673
19010bump20839
28999bump32749
7832bump25203
30784bump4079
1547bump21227
27299bump17566
16049bump13854
26073bump32724
13517bump20951
14541bump13275
13390bump6612
16790bump23169
21400bump32633
20054bump25199
31623bump27078
1378bump1718
12465bump27015
6307bump17579
492bump32202
18492bump25589
16401bump31894
30828bump17636
25343bump29658
24246bump26885
16354bump5796
2624bump27123
29877bump2707
19322bump21103
11525bump10639
16127bump3507
9208bump2999
32704bump24836
1935bump28059
17503bump9095
8488bump18092
27609bump10325
26439bump9201
15720bump3793
23701bump6907
24488bump27962
24617bump26906
19192bump2428
21255bump4817
15139bump5196
14054bump6024
25664bump6771
10807bump3457
28374bump8298
25954bump14861
32580bump7208
7507bump31232
19552bump16696
28469bump3682
2399bump21262
14717bump8551
9973bump29083
1579bump6049
12220bump5151
27212bump373
17370bump9791
32452bump16588
30687bump31575
22090bump14090
6892bump3089
5300bump3908
10266bump12855
2933bump30894
26393bump22213
32612bump25938
24bump17987
31679bump8456
1765bump8017
22127bump21666
16726bump3972
18829bump18791
11495bump21104
17958bump195
1956bump9990
25659bump29756
24650bump12065
5132bump4520
29097bump27995
29847bump18333
19788bump21797
29531bump13866
6492bump8471
6497bump22468
26050bump25476
10621bump13955
23692bump1362
29650bump399
20882bump9992
660bump5845
30041bump6185
1042bump21758
12087bump22721
5619bump18849
25272bump22845
21951bump4023
9281bump27775
23202bump29264
8435bump8242
31853bump10117
15826bump28507
3038bump14254
12839bump817
24609bump25813
8483bump30255
23958bump9834
30404bump19815
22997bump3383
3069bump7193
240bump9111
22033bump1412
8184bump7651
9536bump4348
30914bump28462
13989bump1085
746bump5682
7519bump14335
15897bump13961
18159bump6859
31108bump21025
7905bump22028
13493bump14058
5551bump18793
32142bump29905
3810bump20562
28555bump28658
31354bump1497
14407bump25353
7568bump31428
17730bump26154
20026bump4576
32481bump19891
9903bump30360
13494bump30078
29611bump25029
7938bump19547
25109bump8392
6520bump13245
12256bump4823
31556bump1971
25647bump4244
12364bump25370
21180bump29156
30646bump29714
28282bump9726
27562bump29870
12153bump4546
13913bump7152
4106bump10317
6206bump6900
25893bump29130
9123bump31339
5639bump29834
20840bump27723
30495bump13400
21248bump26053
19499bump15366
17852bump5496
13727bump25932
11084bump2532
3398bump21203
19331bump7201
30251bump20620
25434bump29392
9146bump3654
17720bump12627
7203bump26752
20080bump10041
31231bump13179
22027bump5116
28982bump15508
30921bump21231
6944bump30161
26210bump882
19946bump32698
5137bump360
828bump1386
30803bump16875
4632bump7909
13293bump26686
16390bump11692
19500bump9986
28014bump26511
23152bump16813
24901bump963
21740bump16953
30699bump15924
21671bump14105
14676bump9500
31942bump3441
6759bump25813
26382bump23430
28067bump1516
14757bump12148
18184bump20854
18968bump13855
22325bump20391
29090bump20075
462bump5280
30380bump23728
13088bump20361
12176bump29288
14600bump20448
17058bump7723
8976bump29968
10097bump30686
28124bump15430
19786bump15655
32197bump24704
2814bump4643
11459bump16615
15333bump14940
28560bump350
11811bump24053
22026bump6491
17962bump12072
27354bump17653
31617bump1011
13907bump3135
4803bump14349
26780bump21717
14570bump27423
28434bump12724
25549bump28465
30952bump25935
7144bump31586
12048bump18911
4956bump30429
9055bump5114
11830bump28680
15084bump9063
24564bump5119
6073bump22065
582bump14912
17813bump4602
2321bump22696
11840bump30610
14265bump29598
6353bump29896
15264bump24206
14421bump10368
20458bump24729
3513bump19718
20100bump4490
8426bump7330
21092bump780
21818bump25709
20242bump2587
23814bump14690
16743bump15545
4245bump952
23956bump30690
11332bump21616
24167bump449
14816bump14634
22986bump7204
10580bump572
16013bump6958
23684bump12037
24421bump21579
10872bump29823
12084bump31081
7613bump4628
4746bump13414
29192bump26803
27244bump5828
5405bump2082
15445bump12708
12015bump9878
7035bump27122
29961bump13953
14163bump23773
19756bump3755
13143bump26762
826bump22660
11271bump11529
5714bump14521
3374bump6536
24893bump26117
7526bump22982
8713bump8778
25310bump14283
9459bump18912
17755bump17879
5771bump27948
4477bump25752
16658bump10357
16708bump31135
14631bump11764
11730bump27157
15779bump13866
3699bump11690
20161bump19063
26842bump3535
16514bump7655
22190bump25893
19535bump26703
17477bump29493
26080bump30617
3247bump6241
22366bump27484
5878bump3610
26820bump20144
22692bump28500
5771bump1088
24966bump9527
7046bump14496
21680bump3096
21003bump20193
29377bump25767
12371bump31587
6504bump25962
25635bump235
23591bump106
20908bump17397
6743bump12588
31153bump10316
13933bump26338
2791bump27863
21115bump24291
8865bump31158
13818bump857
172bump21646
16582bump8761
12920bump12064
3946bump4217
31097bump17441
13470bump3453
28877bump30277
11278bump31442
13855bump26014
27229bump15390
6603bump28452
11882bump21335
6723bump19093
30674bump3380
11953bump14975
18102bump20961
9438bump666
2238bump28151
5714bump6236
22365bump26539
14525bump16840
27479bump13382
3477bump5767
27009bump25045
13569bump5945
27848bump2337
26614bump20237
29045bump7137
23967bump13199
1456bump25391
8195bump14018
25410bump16953
5090bump16239
22175bump4409
14303bump31676
5923bump9383
24293bump16896
29852bump21676
27075bump29654
32265bump6363
17433bump6001
1441bump3100
10360bump6959
9751bump27880
28613bump30576
11549bump28092
28638bump8872
3879bump27079
11648bump2995
18545bump20966
25961bump3689
20291bump26067
12473bump5747
31604bump3482
18590bump25693
1837bump26444
11568bump10475
3311bump23798
13210bump27313
9943bump22228
16251bump27102
4897bump24003
11148bump30297
492bump16885
9602bump27663
28732bump6632
310bump18827
13381bump11673
18179bump5319
7911bump8693
367bump577
22133bump30864
3598bump4690
20154bump14233
30116bump6331
574bump19982
3978bump25217
20677bump2092
29779bump28156
10009bump10282
942bump26922
21513bump30502
398bump27209
11954bump25184
3721bump5796
29181bump30886
32638bump11181
29033bump23567
22651bump7756
2827bump31724
28382bump17527
31443bump11004
30394bump15619
29456bump26079
32636bump2489
7734bump24013
9166bump4013
28127bump7048
28859bump29131
23313bump20111
18452bump31155
31679bump7317
16915bump711
4498bump1329
21055bump7041
30185bump11735
13199bump20747
1822bump10759
24530bump22793
31499bump5060
5710bump3513
15052bump2120
13736bump28735
11207bump23798
27908bump9530
2538bump8336
2156bump8091
14132bump15530
23670bump28087
9335bump19295
5409bump23707
14172bump30018
27649bump26015
20903bump27543
2460bump6718
23996bump21188
5651bump548
1122bump12546
15621bump8073
28616bump13656
10416bump3518
16326bump27338
14425bump28165
4964bump11214
30190bump5798
19360bump27135
3819bump14399
27500bump7701
21626bump27996
14583bump29717
1758bump26695
1069bump1989
28689bump13090
13953bump17763
4524bump13874
4074bump17046
27144bump30846
13611bump9125
5283bump20121
29528bump24807
18885bump27580
23702bump123
355bump2327
8738bump6200
15683bump5993
20373bump11239
15969bump11983
19302bump15280
10642bump12505
16560bump5843
24423bump20707
22069bump18073
2900bump30371
22180bump9609
11793bump12030
11799bump30430
10049bump7968
24800bump4665
594bump11723
24453bump30612
2724bump22255
23561bump24439
27373bump23932
1133bump7022
23516bump20340
18039bump23226
9724bump4164
178bump10055
31452bump23892
17590bump11998
26989bump221
3753bump11420
29099bump9979
5638bump1699
31615bump2307
7069bump29711
13540bump25366
22748bump16172
6986bump26614
29772bump30694
13367bump10009
8030bump10880
14644bump6396
16744bump28297
15079bump17850
21483bump25100
32637bump14813
21527bump25864
8267bump15732
28049bump10527
10932bump358
17011bump27026
18509bump14085
29845bump24429
12863bump17894
21515bump17919
29677bump5105
22254bump909
16599bump5044
15968bump19016
25022bump3324
3274bump17787
32010bump21415
12648bump9993
15976bump24756
3336bump10519
8631bump412
13326bump22534
25893bump4581
4540bump14500
26261bump29428
20656bump7843
28741bump13859
11438bump18250
14509bump11539
4512bump3178
6570bump21572
11227bump17300
17115bump19426
19876bump7561
27467bump21218
19955bump6642
18001bump30798
17527bump25425
16309bump30429
18137bump10040
17172bump28359
2885bump16057
4742bump29143
5159bump15133
28797bump5570
18738bump10968
8433bump183
8615bump10941
1466bump9271
17364bump5999
23101bump6695
15835bump29464
21066bump22564
15284bump21341
8261bump11542
24181bump27537
9860bump15624
6353bump1832
22521bump28471
13535bump2159
3089bump616
26397bump16251
18907bump15231
4789bump11615
20077bump25166
8959bump1955
21124bump171
7750bump4081
21354bump6085
21967bump5136
25373bump16312
22295bump10775
17325bump25950
605bump31962
20966bump6760
27232bump15529
815bump11182
24938bump2106
31410bump29124
22413bump25059
31165bump4046
28205bump1292
12136bump5269
25791bump12261
11129bump12762
17103bump13652
30852bump32234
25416bump27442
8535bump29554
17648bump18614
9621bump9109
17458bump18737
8608bump20028
8736bump26364
11708bump21677
31928bump17071
14450bump14944
7270bump19092
24627bump10253
15051bump30300
4158bump9482
9917bump27408
25796bump31444
27023bump6986
6729bump30444
20882bump14244
3149bump32484
1499bump881
1836bump10937
1863bump25003
28995bump22883
17085bump11821
3924bump29611
6323bump14114
26667bump20797
32244bump27326
2946bump29694
6560bump3372
16419bump3487
1140bump2759
23884bump883
3403bump14988
21335bump25725
9957bump9423
10138bump1486
25320bump8750
26509bump14606
7716bump26308
22314bump20824
16923bump19871
24218bump27211
16321bump30835
31501bump9565
10112bump6031
14058bump20851
639bump28177
27944bump12463
20772bump26198
23547bump20617
21208bump19125
19124bump10274
31498bump30317
18146bump28884
14198bump4827
15550bump27918
27559bump13553
28358bump4447
17850bump28387
4263bump17360
20582bump10787
2400bump9591
26169bump23952
8357bump6729
27172bump29675
7041bump816
26938bump30346
3136bump24158
2485bump20560
22924bump16864
27450bump15580
16598bump25718
23646bump14337
22520bump10402
2408bump374
21016bump24063
2136bump2255
3023bump11476
26153bump21932
8842bump24553
6484bump16433
6961bump153
32149bump3510
23559bump31017
15601bump17855
32210bump12632
18936bump21294
14395bump22839
20296bump17847
28023bump22075
14418bump18325
6439bump1681
14177bump7035
9853bump20145
27864bump14030
29089bump9526
5050bump19473
30803bump4333
22384bump22945
32209bump19756
14023bump4258
9723bump2149
6201bump10297
19381bump28922
29549bump28923
5773bump1107
13313bump15526
5022bump21551
14726bump28175
21939bump13879
6348bump17756
24752bump4569
608bump15475
25646bump16467
29268bump1971
2406bump13070
3390bump3809
22608bump21550
20099bump29285
30732bump21863
27606bump28854
20096bump24850
4603bump16403
17219bump24960
24273bump12404
10681bump21134
15503bump10688
5760bump20857
590bump23104
9227bump24308
32200bump10580
27277bump1912
19039bump16996
12057bump26076
6497bump19482
3591bump13349
20362bump8142
9369bump24223
7114bump5442
32223bump19757
27465bump13968
18135bump22237
24233bump28768
3545bump5055
9355bump4702
4402bump248
23892bump13292
24848bump11026
27697bump20755
22686bump21142
22872bump13248
12911bump16093
10641bump32045
15392bump13091
20213bump25501
27961bump14813
5878bump30796
25941bump14924
14752bump2470
5507bump3155
28191bump30135
6379bump32390
10368bump227
181bump643
25788bump1239
5926bump29573
8946bump3007
24076bump11062
30964bump11193
19549bump22725
23813bump13962
3867bump20025
3553bump4497
20858bump14341
15358bump18937
20549bump29404
22546bump14642
15486bump29638
10965bump19873
12613bump30324
6664bump19350
16634bump26064
16054bump6783
23974bump13017
12474bump29276
8343bump3502
11137bump32115
13643bump13544
28689bump16965
27536bump20269
2122bump27072
13544bump771
20332bump13750
4402bump16609
25562bump15246
11911bump29580
26142bump14138
16483bump2721
10540bump2665
20997bump4973
14315bump15357
6168bump21509
21489bump3007
1426bump7315
20878bump28241
10205bump17135
29965bump1381
3637bump31855
13622bump26669
16465bump2559
1816bump20498
2117bump27252
5893bump32169
5031bump1821
4829bump27107
12272bump3739
27024bump6020
9766bump29171
9182bump6358
31160bump14306
14945bump7582
3754bump6769
3278bump7503
31473bump8904
24184bump29054
1825bump14151
31765bump29846
8773bump20435
28357bump30925
19726bump17518
24656bump11094
16433bump27147
5295bump14296
21002bump29088
7375bump16416
24453bump15740
9873bump31763
15422bump8411
3605bump5606
28135bump15800
5176bump5777
14059bump29922
24155bump30336
13392bump7250
9063bump9868
4834bump28604
10765bump9515
8078bump28516
31827bump29667
14092bump8499
29772bump261
22721bump26634
1574bump22935
24803bump25942
27499bump14226
11742bump6373
4992bump16462
13558bump13048
32114bump1850
18990bump19609
24305bump10448
8041bump31278
15517bump4552
16080bump27727
22401bump18060
1139bump4821
5085bump16109
23347bump30259
15657bump10772
16607bump15114
19286bump11963
21917bump1015
3415bump31645
31372bump9648
23776bump15402
17319bump24911
16238bump17792
16621bump6381
6279bump3991
25279bump12915
20803bump20155
32137bump7341
6411bump16704
12452bump10912
9121bump1393
13435bump14622
2144bump3017
21485bump21143
9926bump31078
5363bump17714
13359bump3770
21635bump24348
22243bump26244
22964bump17696
29267bump8446
9250bump6009
2208bump20312
31124bump22756
21853bump13158
30428bump19449
1430bump10134
10239bump15034
12561bump17188
27542bump23661
30931bump3729
9588bump19879
28390bump23633
1161bump20138
11098bump6596
24582bump15344
12938bump11367
28610bump29960
4257bump12108
25565bump9633
20060bump9415
8099bump9445
8977bump28779
7091bump24328
2032bump11572
13152bump32032
4233bump13318
24919bump16183
11406bump26198
12162bump15518
14042bump4391
24109bump32389
30131bump31801
1640bump10441
28748bump31101
15276bump9485
15758bump2251
28865bump1036
12312bump25559
9182bump2349
901bump1634
5651bump5209
28397bump1709
4580bump24073
16558bump21043
1335bump14755
26476bump8855
29296bump20998
3158bump16092
31962bump5219
8875bump23764
5193bump15696
4221bump14043
1021bump15383
21686bump10693
26826bump24660
20056bump28436
21110bump1471
2313bump18286
5219bump12870
13006bump10575
2413bump23135
7959bump18428
20246bump16284
31484bump1720
15329bump7551
5830bump11321
5371bump6289
26801bump27229
18208bump9134
11504bump3610
9917bump20387
18162bump27571
31570bump14587
18404bump23346
23067bump2069
15991bump22802
5103bump14202
13283bump7996
14952bump5230
31276bump18997
68bump11717
12195bump24213
30987bump9464
7089bump17083
31730bump5496
18640bump191
11776bump1602
32730bump25768
30575bump6580
2182bump19167
26709bump28575
21295bump13028
20612bump28061
28632bump27200
3758bump24997
30318bump25531
23245bump13020
17484bump3790
4033bump5294
13061bump17243
14395bump28702
11357bump5532
25307bump30554
16280bump9818
405bump6035
7160bump17247
22617bump15627
5249bump27693
16115bump7536
4351bump3824
14896bump31848
4170bump4530
12354bump7789
8137bump31694
15461bump24027
27701bump21415
26051bump5703
20383bump1177
15765bump23059
181bump24880
10380bump9791
18241bump5528
22383bump2178
23026bump7765
13061bump27546
18783bump5940
16181bump32224
7241bump30338
14700bump26143
288bump2171
30271bump15014
14537bump16133
16978bump28316
7839bump10655
19064bump10644
29112bump10644
20251bump15713
17257bump13940
9951bump11820
12044bump18116
21634bump196
16128bump12533
13319bump17204
8946bump6291
787bump923
7003bump15295
18583bump10552
15946bump13535
24495bump25541
31076bump1172
10698bump9478
29993bump30701
11276bump22689
15737bump16090
7152bump20016
21334bump18147
7986bump2453
3051bump11801
17132bump28045
24781bump25165
28159bump29833
5506bump16513
21172bump27577
22080bump18588
9123bump25705
13302bump14690
4052bump20368
8593bump10402
18981bump30630
22136bump27569
8171bump19639
14936bump25624
25308bump14006
15911bump1162
10797bump25107
18019bump8729
12023bump14991
2715bump26025
18399bump2128
3633bump29092
18422bump25392
5726bump4079
17630bump28763
16758bump31773
2095bump7705
9070bump7651
12312bump20968
2971bump18380
17226bump15566
22460bump20014
15377bump18925
30779bump2653
20164bump23384
2480bump7710
28512bump18725
10151bump2911
23152bump22212
23715bump29733
9520bump4751
21347bump5829
6385bump21409
11619bump23127
23999bump18924
8870bump32616
14402bump21638
20147bump18671
24290bump4676
20190bump12674
10798bump24714
5576bump202
9343bump15457
6185bump21813
15576bump14794
14029bump30186
8465bump1363
2525bump258
821bump9191
29024bump18933
20008bump25834
3841bump31826
3469bump14982
3347bump22196
3302bump27711
22226bump4593
29181bump22478
9708bump18580
22148bump13356
2368bump29326
9464bump2797
18661bump18728
15563bump23503
19310bump10044
8641bump7827
24684bump14757
15003bump5899
5173bump5108
25331bump12149
28900bump32100
21607bump19719
20641bump2577
11001bump21195
9507bump21604
2230bump18093
22642bump27346
7318bump19667
10994bump17862
4260bump27948
12957bump23003
9054bump22348
24464bump6735
28767bump6263
10697bump32693
11323bump30715
19503bump26345
22443bump28099
12498bump23625
11754bump26410
29301bump10018
21086bump19981
5962bump10601
379bump1572
26876bump26540
18661bump21650
3570bump19783
2772bump26042
18387bump219
20669bump25941
31557bump23804
12591bump23745
25851bump24874
19707bump19356
8174bump12035
10135bump11922
24810bump26550
24260bump26739
2893bump32187
1391bump16777
780bump20162
9685bump28968
24566bump6633
12011bump25990
26173bump9777
20733bump15821
26674bump11571
3477bump10863
30032bump24079
32414bump10170
31356bump3238
6345bump18092
14219bump24841
27952bump30728
11781bump6960
11834bump3497
27944bump16112
31678bump26135
24368bump15399
14955bump30296
31702bump26426
31335bump9737
1047bump21953
12598bump12717
11062bump29568
19166bump1860
20740bump25498
22088bump20768
12639bump513
20714bump8948
11513bump6449
21923bump32046
3931bump8222
13030bump6790
30249bump5226
11291bump15319
15783bump17628
27202bump26158
5756bump8206
24538bump18209
10422bump23397
9217bump13155
26639bump1606
2268bump29589
32110bump23943
28985bump21342
27057bump29476
10611bump9917
17834bump32308
18326bump14750
17255bump26395
22212bump23980
21687bump25600
20952bump2663
6889bump14722
12616bump17270
983bump29606
4176bump14654
14372bump11028
11597bump22451
16065bump10884
18791bump14190
31158bump2163
11122bump9473
24607bump2330
18966bump12935
6516bump23712
24878bump1919
24078bump3471
30319bump25306
16615bump13189
4426bump850
18082bump15916
10771bump27134
28107bump27755
5218bump11043
3167bump17374
26810bump16718
9871bump7300
12648bump5791
8897bump5304
24238bump14440
32472bump355
17953bump26871
27317bump11887
12624bump943
27645bump895
16294bump26462
28445bump24797
8082bump23242
27020bump18611
25316bump8077
29008bump10367
29307bump10019
28100bump22209
25885bump7746
17816bump6390
15782bump17001
11801bump17866
21605bump13756
32691bump22410
28611bump17679
13236bump728
20517bump21569
28498bump9634
13076bump25803
16368bump8789
4508bump27288
27805bump31565
7665bump25368
222bump17041
17497bump25232
29869bump12733
13125bump2996
5569bump32319
11969bump9591
5648bump15814
13071bump17186
25491bump28408
10895bump12963
11593bump31332
15075bump9512
14718bump16311
27983bump17901
29005bump818
13926bump13138
17764bump20315
8419bump3633
20487bump7923
8149bump4974
22616bump25385
19455bump29648
6869bump14861
4222bump24079
31522bump26951
2732bump28462
777bump28937
8517bump32010
21183bump19266
5832bump28468
26216bump11029
6944bump6652
21726bump20617
8324bump20430
27566bump17538
30620bump7362
19556bump4336
30437bump24686
28425bump18758
12630bump14847
11753bump30510
68bump31368
16026bump16250
25731bump4505
15417bump21342
718bump10260
9975bump477
16232bump23868
31956bump32130
15620bump23055
20395bump10832
17123bump11990
31855bump2043
20028bump12026
26548bump3161
21216bump16153
25457bump531
28446bump18777
8708bump16288
5860bump19452
23158bump19060
31272bump13877
513bump14964
10886bump1850
16079bump29102
17451bump25499
30725bump31815
7665bump5330
9984bump11444
17611bump10011
19934bump18477
18020bump6534
14145bump22367
3843bump21578
25423bump28514
24242bump22876
17918bump1770
6559bump25408
14990bump11201
30658bump26144
20567bump11381
22464bump10011
21700bump2638
14608bump24031
16032bump18306
8540bump5242
24208bump26028
28970bump14701
30945bump10363
27579bump6146
11396bump28839
30259bump10976
19287bump17194
20987bump31965
1959bump20652
22116bump3091
6898bump4415
28045bump25398
18929bump18508
22662bump23845
27093bump1229
32437bump18110
19154bump29117
19577bump21239
11226bump2765
25870bump5418
7083bump2393
11185bump30129
27403bump7578
26628bump21683
5202bump18461
2483bump20285
15402bump26484
20312bump23189
12179bump20011
21660bump10699
810bump29950
19359bump4496
14250bump7496
26011bump24139
1971bump30655
11972bump20586
17098bump9055
24946bump13046
22946bump6308
29825bump16491
32665bump21756
26872bump18886
1414bump23164
6890bump21471
20914bump22482
6554bump7929
6436bump3195
19170bump19608
15906bump15670
24022bump6035
30708bump19640
20644bump21097
10219bump19617
3519bump8152
32674bump6831
25660bump6572
23684bump24113
24444bump22998
31886bump31167
16907bump6589
28758bump17705
10184bump23513
28237bump9133
4934bump21373
27457bump19053
27251bump32500
7206bump19232
9847bump10192
17685bump14087
15071bump15743
31125bump28194
30715bump15903
12826bump28325
27780bump8595
23243bump14502
2690bump31447
16264bump6680
4973bump17296
31020bump30460
3987bump1512
16399bump25046
21689bump22680
18384bump6238
24581bump24902
2129bump14457
1820bump20754
6146bump16743
17543bump3948
31587bump13630
9051bump1832
3524bump28311
3609bump18900
26447bump32391
1235bump32073
25673bump9937
32400bump18304
12693bump17497
31218bump11431
634bump15836
278bump4980
21414bump19167
9404bump25530
24434bump9957
12968bump29498
10087bump1253
11080bump13499
14081bump22267
14998bump23901
948bump15966
14400bump29738
3629bump14226
29446bump32750
10458bump22239
19300bump18248
1964bump10497
24946bump22274
32028bump3105
23048bump17054
2156bump5380
32549bump21297
6447bump21635
16274bump6261
11275bump4411
20930bump4121
9406bump18821
32253bump22363
2399bump4521
21438bump6873
742bump8782
20057bump14500
18159bump11061
11488bump18583
20155bump15911
328bump32487
32632bump26156
15048bump7418
10178bump16126
12162bump25725
30313bump8381
26981bump16561
20085bump13284
14930bump6661
7271bump380
23421bump2026
4290bump21392
7191bump21731
25546bump31200
25386bump2267
1676bump18137
2244bump28092
25886bump22725
19031bump16957
7720bump832
24160bump3836
21411bump27883
27463bump20940
30945bump13668
25990bump29520
16846bump14197
6414bump15049
6005bump15243
25062bump13356
13766bump11882
22550bump15480
22166bump12320
29379bump10310
3559bump3895
26267bump14497
15210bump1071
17268bump21017
13634bump16684
5423bump10771
4107bump10731
3043bump24163
10267bump18426
28472bump11037
20487bump20265
24848bump12967
18537bump17980
13165bump3091
25825bump10210
21903bump2988
602bump4075
7260bump31183
12943bump18613
27141bump11261
16589bump19687
30951bump13357
29690bump4450
19887bump6759
12758bump11125
5314bump21646
26497bump10064
28380bump28798
23358bump8892
28918bump9303
19318bump9
23406bump14615
32512bump17735
19554bump879
10911bump31673
29020bump24271
20428bump9094
31797bump24260
30902bump4018
24371bump10883
30088bump15949
5237bump14022
32490bump234
29841bump20950
25034bump2387
24699bump13801
6236bump11899
17065bump5551
29791bump32180
11124bump22312
16035bump27682
3266bump28856
28616bump15472
22754bump7293
26184bump27841
2231bump21984
15800bump16618
19737bump21866
11082bump15582
28536bump32474
919bump9065
9666bump30068
19867bump19746
23943bump19099
1793bump27547
16988bump31394
32161bump3290
893bump11232
25160bump29453
7350bump25602
30903bump5241
9859bump10149
2286bump22452
29046bump14373
30122bump24596
28889bump25519
7212bump32359
14485bump7070
24892bump6628
4690bump17668
3950bump9570
28128bump30598
27300bump29896
12501bump7790
7380bump1733
10616bump12283
24587bump5825
10462bump28411
2482bump2835
2131bump27292
23313bump4980
7676bump12416
15121bump2995
25786bump25871
15686bump30379
23376bump13841
6700bump9587
24265bump23420
31921bump24276
1044bump6794
18676bump6912
13554bump32527
16461bump10112
5138bump16138
9869bump18287
27769bump31866
19591bump9190
12328bump22899
9167bump8375
18937bump4720
16321bump26974
18123bump4843
26565bump18996
6622bump14379
7890bump10726
128bump13918
17457bump14118
18666bump21479
12676bump7840
101bump28409
31238bump23856
19633bump357
12052bump594
29862bump5808
19949bump30426
23580bump26729
15030bump7141
30473bump5305
27841bump22031
30697bump9020
12302bump22758
15715bump19471
8210bump18079
17193bump13611
16312bump30728
6688bump6641
21158bump190
11201bump4357
23489bump17312
19647bump25696
25843bump11139
25321bump12193
29740bump23592
8787bump14500
20902bump28523
9648bump13910
878bump4796
26115bump31176
8736bump6355
21879bump11650
27377bump21408
8586bump7961
13043bump19073
24689bump18180
8085bump8376
11704bump683
18537bump16412
31274bump13505
9771bump7182
4848bump16340
29438bump8367
9213bump3874
24568bump8785
14761bump8623
17377bump24875
1435bump19348
10040bump30032
27373bump8602
20855bump14050
5515bump17159
15257bump30338
8412bump30136
3032bump6668
4517bump18544
32443bump29057
10026bump12144
24912bump22597
18326bump20296
182bump30347
2972bump27116
13023bump14093
11615bump8714
23700bump17664
24207bump2203
6330bump9799
18901bump10425
25811bump17895
17266bump1456
30408bump699
27939bump16215
8165bump5737
20807bump20641
24869bump26772
14659bump7279
5296bump8787
17190bump15528
20642bump5602
31369bump18316
26382bump20120
30906bump32581
10051bump23833
20505bump8127
17485bump13261
18113bump16058
1215bump10129
9323bump29214
8112bump26796
6032bump12430
27396bump2052
30158bump8255
16109bump23698
23437bump18443
12976bump23827
28386bump22209
5805bump16896
18868bump29888
20378bump961
20253bump21444
30479bump2334
28690bump28927
25927bump6646
9031bump15724
2085bump27187
5197bump8288
11125bump20733
19965bump2146
5749bump46
25626bump32316
8851bump20486
24626bump28242
12153bump29473
30149bump7219
6215bump9893
16810bump29806
3615bump12992
6317bump12455
31719bump20306
10621bump489
22346bump16614
30150bump13630
768bump16871
26266bump1661
9808bump3089
21bump5476
7635bump5669
30785bump12518
27002bump23009
13623bump27846
15314bump13871
30343bump13669
3719bump16797
11738bump21977
24616bump8461
19158bump9278
32553bump13997
32322bump18513
1582bump15658
14443bump20539
28039bump8993
26310bump1962
22006bump15063
13526bump17702
28857bump4649
21584bump8611
10436bump1734
4222bump20050
29007bump27291
12513bump31933
23952bump19599
28442bump3347
26058bump14705
1035bump30400
32134bump2350
4153bump8001
24352bump3144
25460bump4919
12422bump11651
26555bump21946
25917bump23522
13146bump14831
421bump20689
1621bump31453
9085bump1700
14089bump1404
29609bump29504
21009bump10511
25907bump23320
29031bump8628
26001bump20572
3787bump12602
25126bump12908
21865bump14898
18187bump16787
14006bump4425
23310bump6898
18075bump30933
7419bump12474
8917bump31405
1563bump4767
27036bump5182
22011bump6793
898bump26843
19310bump20876
17567bump28245
28373bump8474
10475bump18380
20894bump9335
12267bump17092
26379bump11886
7056bump10875
23093bump22339
5724bump25979
1360bump9960
1222bump4459
28208bump12147
1504bump4394
27660bump11216
26423bump16671
23171bump30387
4090bump17866
32220bump28113
10079bump10399
31890bump5456
31299bump14101
4624bump3964
25617bump22522
24249bump15547
16100bump19209
31019bump6083
7920bump1726
9413bump8714
23838bump10345
20839bump29822
13558bump10882
18552bump18551
31170bump21820
11054bump3306
9968bump7516
9737bump23519
20409bump25932
32161bump25637
12800bump21611
22690bump6980
28797bump14504
27413bump19379
14362bump9807
26337bump21323
21661bump18978
21905bump9724
30856bump8620
16215bump26815
15421bump3538
17233bump14539
6246bump29611
1292bump29452
24468bump24466
4935bump4049
31526bump24185
11257bump26309
28525bump384
405bump28448
27406bump16326
25996bump20510
26023bump10878
31763bump21937
4533bump10054
23848bump7538
9653bump9397
18127bump4062
16521bump32051
17570bump31167
27934bump31758
28808bump23016
2380bump14538
12485bump14117
5117bump15544
5939bump4722
9874bump9930
17870bump18795
7554bump16805
31862bump32004
13380bump16376
13297bump20602
6256bump4876
27184bump5258
14369bump3997
979bump13024
20381bump21737
26351bump28114
31288bump10758
13070bump18510
19061bump17784
14967bump10769
11631bump13059
8368bump5146
7543bump19390
16962bump31071
26623bump29801
18876bump4030
2743bump5632
5626bump11574
27637bump1168
21927bump1367
29274bump18506
31745bump23287
16307bump31958
29404bump31271
4893bump15082
11754bump3686
5741bump16410
825bump10516
6862bump18674
27901bump3113
2220bump20802
6288bump3366
1745bump11961
26295bump9292
7374bump14773
16679bump31756
21661bump30810
26952bump5312
8068bump32738
9272bump20632
572bump51
26643bump31703
19539bump11703
28274bump9535
24271bump32104
20529bump23241
17940bump26410
3702bump7834
11016bump8798
11502bump10291
24436bump4276
16730bump17896
2478bump19264
7243bump29331
13173bump1489
28457bump29577
16412bump15486
4986bump4813
3563bump24449
22369bump18820
18114bump29001
29541bump28329
9215bump19146
3444bump15874
10658bump31256
27944bump19283
7343bump28468
17737bump13777
14548bump27429
13970bump12249
26956bump25931
28600bump12002
2307bump23281
3752bump22449
28155bump15649
10000bump31436
17390bump28860
4642bump13616
31285bump5322
27541bump2374
18664bump782
24556bump1044
4423bump16093
12282bump17072
7512bump17969
3494bump27643
722bump30970
13804bump29323
11578bump2740
27684bump13033
21324bump12862
14983bump16893
23452bump3050
7151bump32710
29821bump25041
29406bump16975
25378bump20073
29122bump11486
19971bump27993
22647bump1902
1666bump3723
11022bump10847
5583bump8067
17869bump21101
4361bump16112
29302bump28895
30886bump11905
25293bump19456
10004bump5882
13396bump979
4768bump21127
24921bump20227
26264bump12624
17202bump1049
14252bump27725
2504bump17137
22426bump14940
19538bump21103
3083bump15249
5987bump1646
11447bump11981
7207bump16889
27856bump9618
25833bump27070
21406bump10773
13017bump23231
10343bump2965
26893bump14667
21905bump17644
10437bump11309
1802bump12644
755bump22563
2024bump971
25339bump12178
9037bump13258
5815bump27255
3214bump21874
6078bump15009
4756bump3864
31206bump4126
8834bump8547
8967bump499
23959bump13731
12290bump12048
18007bump26212
11010bump11138
18661bump13892
30466bump19947
8884bump26881
5264bump28975
27998bump29398
9168bump32369
20692bump29192
18371bump21310
8376bump26300
20169bump22535
26887bump7435
17509bump23253
11771bump32088
20545bump568
25392bump14049
1650bump27776
24069bump30869
3324bump20272
18245bump11302
15001bump10928
20487bump26462
4790bump26178
11730bump1974
17087bump26679
8709bump11301
1180bump32355
4214bump310
2684bump10958
26970bump4957
22481bump10412
27237bump7051
11163bump15760
31538bump31232
24554bump10972
10468bump21345
25246bump21372
1294bump1034
11122bump27092
27600bump23973
21305bump14838
30019bump25339
12391bump25625
5655bump30219
7378bump6983
13179bump11353
18618bump15445
11837bump15753
16135bump20760
10547bump16428
32467bump21462
3801bump10458
20008bump18171
6715bump16257
10763bump29965
26390bump32508
30649bump27874
19770bump4840
23344bump3601
2866bump26547
22257bump14758
1063bump245
6405bump31514
5378bump2564
6462bump15746
17617bump21699
27839bump24838
21612bump15034
29374bump17557
29016bump5228
16009bump6103
4075bump15076
25287bump2403
12465bump18322
513bump9523
5391bump1621
18529bump30548
10022bump19929
12985bump18146
6394bump12835
18118bump32052
32468bump17770
8375bump3412
26853bump23337
31209bump28594
16427bump370
3317bump1561
27289bump9349
31468bump31713
31346bump4257
5601bump30311
27894bump17946
13480bump10682
15424bump21420
29662bump9623
18543bump11023
2089bump28312
23556bump9163
1473bump14248
20363bump8270
16688bump20410
4222bump2364
11606bump6075
3942bump4870
23215bump5316
22851bump446
31705bump29333
24622bump24362
4944bump2623
14141bump22295
11901bump16672
17831bump11759
20975bump21524
13608bump1422
31464bump25322
8103bump25682
23067bump20501
16407bump12913
11188bump18596
10907bump8592
20633bump2165
20461bump12945
3311bump11941
20480bump19884
4065bump13898
24548bump8385
10396bump26469
18155bump14316
19614bump21522
14090bump1115
21297bump13826
1153bump17756
2610bump16427
190bump1978
2071bump14526
31871bump12106
24369bump28506
13624bump16065
5677bump25471
12724bump20936
2529bump12101
20990bump32083
7238bump2638
5762bump2606
21696bump30969
25200bump15832
21926bump31704
15713bump9621
19198bump21349
22589bump6079
13960bump11248
22876bump24413
15615bump17884
13291bump17911
22683bump28171
3730bump28584
5338bump23191
32083bump15732
14208bump16323
4790bump10716
31452bump12593
3107bump21424
15694bump9045
7567bump11045
18950bump8489
8283bump29991
7950bump2594
10616bump6384
21643bump27747
19152bump27610
2368bump20274
993bump28529
30803bump424
9643bump13773
7252bump16812
11725bump24607
891bump20258
23787bump27529
14641bump16223
3154bump16435
26834bump9440
1759bump13979
7602bump24380
26909bump1836
17502bump10072
19629bump22547
20772bump11226
17131bump23886
12245bump20960
25294bump16133
24777bump28145
28176bump14878
26404bump2356
20879bump12044
27736bump1759
1268bump4839
15595bump15859
3474bump30402
635bump23335
10385bump6457
24319bump7969
24651bump13897
19791bump19692
4342bump2405
27367bump23719
8324bump13765
3815bump18042
28103bump2306
21087bump31183
15065bump19424
28106bump21694
5819bump5482
4056bump12232
2620bump21573
4465bump20937
3100bump574
10998bump24616
114bump13861
3786bump8017
18251bump2014
3345bump5989
7828bump31413
9399bump28975
23354bump25074
9652bump8027
15759bump29613
18575bump10210
25840bump32228
24353bump8649
9893bump29131
668bump15115
19464bump14691
25292bump23252
31721bump2894
6812bump13295
21298bump12514
11739bump23426
28871bump29308
5184bump14329
30896bump7703
30124bump23616
21114bump23581
31664bump9013
9946bump18044
23631bump8029
24724bump30205
517bump13013
13467bump31186
29960bump25484
30074bump28013
27085bump16304
13810bump8345
6350bump26214
32485bump1475
17291bump2238
7283bump23192
2766bump30438
18018bump16086
31284bump3486
10179bump11611
27881bump6123
2514bump2947
12211bump30992
9759bump17072
1074bump12986
25579bump6186
26982bump7035
1237bump14122
19825bump22905
1206bump8497
3230bump30056
12489bump30878
24995bump6581
14863bump22912
11043bump20996
18161bump13481
10871bump24285
18472bump24836
8110bump29090
5338bump22312
26322bump25797
4613bump19244
31341bump17463
26913bump6333
32588bump14884
4609bump13679
15747bump13277
13307bump7505
10930bump21270
8776bump28100
27014bump32593
30637bump8845
25218bump11162
5467bump10536
23039bump9333
2325bump15967
10097bump31253
7824bump18972
29165bump23246
8223bump11644
5608bump29133
2704bump14116
6210bump7687
14416bump12760
19075bump5487
18390bump16714
1124bump18540
16703bump303
5777bump6538
16182bump6808
23213bump15728
7959bump17280
1174bump22290
31828bump23713
6379bump9255
31511bump8589
11468bump19934
9769bump7929
21217bump12748
25618bump25436
22942bump14121
18306bump7609
16069bump1085
16111bump7864
31788bump10261
26496bump28668
4544bump3194
1834bump30129
28874bump17444
29209bump20068
11377bump2346
24401bump25880
4992bump32701
28821bump27030
5994bump4374
29063bump8964
9356bump29357
4626bump20665
20401bump11692
8197bump3408
31963bump15011
1024bump26619
25409bump1405
1428bump10266
4756bump28083
6822bump28429
23942bump5823
17940bump11334
19853bump7380
18844bump6050
996bump460
12025bump9721
11220bump26210
27726bump11252
25137bump25505
10184bump8990
13863bump6300
24191bump17726
10039bump16480
29342bump29157
17532bump25639
25796bump4675
20787bump32206
15530bump28478
4730bump7817
25861bump11718
10840bump28118
32430bump25954
9214bump5295
28416bump1295
5452bump26884
11649bump31307
31127bump28008
5317bump20077
10666bump30987
14992bump11831
5386bump7144
4923bump4014
8319bump4927
25689bump27177
19919bump25158
19098bump13481
4301bump25372
22255bump7784
30098bump25598
1774bump13749
31755bump9405
7289bump28926
19636bump18543
6298bump20015
10914bump3941
23986bump31803
18119bump27998
15571bump17143
22642bump20474
29290bump7471
7957bump10610
22049bump14580
12619bump4997
16899bump21043
15641bump7862
29921bump7052
7540bump8628
29685bump10592
26884bump7450
12230bump4908
24104bump1880
28747bump16150
20538bump5361
19539bump3014
31252bump20712
12325bump19575
22995bump6516
14179bump19278
31195bump21755
24116bump17898
19227bump29502
19873bump6204
29842bump3794
18240bump2457
15377bump17103
29712bump28685
27715bump2252
6821bump7667
23532bump13066
133bump19906
31342bump22255
31441bump42
1425bump15286
29224bump96
19587bump8550
24008bump694
9246bump29696
31222bump4462
28778bump16125
15777bump15312
26467bump29943
21314bump15226
28924bump24487
6406bump1016
18531bump19471
27695bump28820
17031bump18168
17335bump1135
24024bump32159
24119bump28881
32589bump5804
1800bump21950
172bump5987
13992bump28874
29702bump10526
4703bump11822
16512bump21243
3874bump20506
31834bump31698
15287bump8269
10281bump18538
30234bump24548
12135bump10732
4128bump26991
21038bump12439
10074bump14666
23617bump30390
13372bump20523
19788bump14287
5246bump9207
22125bump26654
5315bump4826
20722bump24641
15737bump3222
4709bump28981
26368bump26139
16838bump29825
22798bump2905
4631bump11441
31058bump850
1566bump2566
19799bump31347
8550bump10092
21420bump18212
10887bump5036
30786bump7326
25255bump15075
10261bump24572
22081bump1075
18446bump21397
11045bump30648
4904bump3210
4032bump190
9171bump26267
12190bump8241
11414bump27199
20781bump9044
9207bump22771
196bump12982
26527bump21458
27875bump19811
6842bump20582
22461bump1111
17309bump20414
16883bump2616
27819bump3008
12963bump27460
19577bump3777
16545bump392
14640bump26963
16644bump31058
27443bump31326
16101bump31210
21250bump32115
8291bump18045
1631bump21340
7402bump27482
2223bump14584
26806bump19297
29346bump24646
14738bump8631
15638bump8127
2278bump19391
13113bump11241
14064bump28486
20462bump3881
29522bump20734
2675bump21464
3789bump28462
22080bump5274
6732bump13479
23090bump26347
30500bump22522
8936bump21499
15514bump15080
21614bump21436
5798bump24090
7960bump32313
502bump15635
31665bump26409
2358bump9826
29397bump22468
26511bump25628
29596bump23253
13421bump18569
32121bump20241
31878bump29470
8545bump29607
27672bump25003
7727bump8984
28273bump8662
7239bump12361
26293bump14024
19577bump6615
26076bump1830
28201bump1962
506bump26435
173bump18125
12995bump5012
9207bump14204
22350bump12132
27764bump24959
18713bump7112
11827bump8887
8270bump15062
842bump11255
3396bump29458
4470bump16405
27465bump1833
21249bump26944
28831bump5602
26345bump6291
8132bump22097
11326bump25579
24054bump25678
11468bump22006
21239bump12581
6906bump1165
30222bump27791
26354bump24900
27726bump31201
12034bump30783
7194bump17796
3906bump4423
6633bump3749
5240bump26396
21063bump31021
22072bump26893
5405bump31732
31824bump15047
26161bump32561
13155bump26219
14064bump16182
21715bump29923
28012bump18266
17892bump24693
23713bump6454
21023bump5528
4604bump21524
1269bump30215
7198bump28836
18085bump4629
11997bump25841
16480bump3136
18571bump17556
19370bump23304
15483bump12583
28931bump23810
18114bump12029
14791bump29480
3387bump12816
22867bump5491
12750bump30523
29033bump5548
23025bump32170
30166bump1151
20334bump13454
29521bump27857
7783bump12565
15783bump22867
21656bump153
18709bump22615
17885bump27416
13045bump29155
31220bump14820
15774bump17412
10115bump22171
17285bump14693
24669bump22106
26024bump3616
21249bump17710
31020bump5844
17764bump17867
30788bump32248
11504bump22913
31318bump27503
1996bump25707
30553bump19036
23390bump16874
23170bump8503
31758bump32081
10271bump12321
589bump738
15043bump18804
4310bump23802
23459bump6303
20532bump20872
14912bump19249
17285bump29635
1862bump20531
23165bump32285
14004bump8635
25774bump2162
11582bump19646
18950bump28294
23792bump11046
11417bump31406
5395bump1060
22432bump10445
2388bump1736
8130bump5506
21539bump21199
6291bump28064
30810bump956
17243bump29151
9759bump29226
6936bump25297
18187bump8032
8646bump26903
5516bump32550
21213bump19924
17287bump5079
7964bump5986
29762bump4280
21893bump24132
3458bump30344
7593bump28252
9200bump24152
26405bump2142
1729bump26269
29293bump22405
11926bump30340
22216bump28549
5025bump19333
10652bump26304
12042bump1339
10988bump24764
11153bump9075
6943bump7381
2420bump10883
7683bump23855
14739bump25053
20241bump14831
29650bump24803
27379bump13483
19647bump24061
12867bump8222
20085bump29673
27030bump12321
6336bump20819
6841bump17879
19585bump1702
31546bump19495
18004bump26145
7210bump14447
27761bump10797
18210bump886
5072bump21998
11396bump11939
16529bump1048
18179bump10605
17818bump6148
6246bump11027
1922bump1283
9096bump21645
26286bump8178
18340bump11970
5305bump12046
24783bump22779
22809bump11274
20934bump31640
2304bump27743
23274bump21250
13953bump9188
25225bump26336
23284bump30110
4703bump16782
155bump1753
28253bump15306
12166bump18551
18601bump12465
8627bump27273
14053bump11755
634bump11804
27828bump29730
15656bump2389
8058bump23480
7915bump20929
22372bump29113
20462bump24806
20905bump24846
26564bump26398
22543bump31732
8458bump24741
12720bump31149
28744bump24816
4350bump15477
537bump10304
8965bump13240
25740bump14200
9200bump11906
24521bump22059
7375bump12855
16888bump16122
11927bump10628
8798bump26141
3690bump32661
24521bump3647
5913bump31625
24111bump8079
5096bump28707
18322bump29972
10385bump5058
21542bump5184
31371bump5267
23990bump713
32651bump15621
16964bump11956
5452bump15485
23024bump7347
18060bump26700
1051bump20656
24919bump2270
4043bump9386[br
Title: The Bumpy Thread
Post by: Phantom on May 04, 2005, 09:13:54 AM
does the [dohtml] tag work? Bump?
Title: The Bumpy Thread
Post by: coolzero on May 04, 2005, 09:28:03 AM
having fun?


bump
Title: The Bumpy Thread
Post by: Phantom on May 04, 2005, 12:51:24 PM
[DoHtml]<marquee behavior="alternate" direction="up" width="200"><marquee direction="right" behavior="alternate">BUMP BUMP BUMP</marquee></MARQUEE>[/DoHtml]
Title: The Bumpy Thread
Post by: plymoth45 on May 04, 2005, 05:57:01 PM
bump
Title: The Bumpy Thread
Post by: Phantom on May 04, 2005, 11:04:44 PM
Bump
Title: The Bumpy Thread
Post by: Saibot on May 05, 2005, 01:44:27 PM
I wonder if I should forgive the bump you told yesterday,
because I hate the morning's light.
Title: The Bumpy Thread
Post by: Phantom on May 05, 2005, 05:13:41 PM
Bump^10
Title: The Bumpy Thread
Post by: Sl0vi on May 05, 2005, 05:53:50 PM
bump!
Title: The Bumpy Thread
Post by: plymoth45 on May 05, 2005, 09:31:42 PM
y1=tan (bump)
y2=sin (bump)

Graph anyone? :P
Title: The Bumpy Thread
Post by: Phantom on May 05, 2005, 09:44:57 PM
Here you bumpin go!
Title: The Bumpy Thread
Post by: CK9 on May 05, 2005, 10:11:50 PM
now let's not bump that again!
Title: The Bumpy Thread
Post by: Phantom on May 05, 2005, 10:14:32 PM
I bumpin concur.
Title: The Bumpy Thread
Post by: CK9 on May 05, 2005, 10:29:39 PM
*pulls out a bagget*
I'll bump you all with my french sandwhich!
Title: The Bumpy Thread
Post by: Phantom on May 05, 2005, 11:43:07 PM
Phantom pulls out his BPG (Bumpin Pie Gun) 10000. I'm setting it to Banana Creme.
Title: The Bumpy Thread
Post by: Saibot on May 06, 2005, 12:33:19 AM
Your bumper is important at any time,
because it give me pleasurment.
It's not a bump,
It's a beauty really.

Your bump whenever. It makes me have.
This bump place also feels close,
if it's your bump.
Title: The Bumpy Thread
Post by: Phantom on May 06, 2005, 06:27:34 AM
Bump
Title: The Bumpy Thread
Post by: Toshiro on May 06, 2005, 06:00:13 PM
I must not bump!
bump is the mind-killer! bump is the little death that creeps upon you! i will face my bump! when the bump has passed i will turn the inner eye to see it's path and only i will remain! there is no bump!
Title: The Bumpy Thread
Post by: CK9 on May 08, 2005, 06:45:05 PM
you say bump like it's a bad thing
Title: The Bumpy Thread
Post by: Sl0vi on May 08, 2005, 07:17:58 PM
(http://todmar.net/quality4u/ebay/books/thump-bump.jpg)
Title: The Bumpy Thread
Post by: Phantom on May 08, 2005, 07:20:01 PM
That will scar my mind for the rest of my bumpin life.
Title: The Bumpy Thread
Post by: Betaray on May 09, 2005, 10:01:05 AM
only the crazy shall bump
Title: The Bumpy Thread
Post by: coolzero on May 09, 2005, 10:02:58 AM
you ppl soo need a hobby :P bump
Title: The Bumpy Thread
Post by: Leviathan on May 09, 2005, 10:03:56 AM
bump
Title: The Bumpy Thread
Post by: Phantom on May 09, 2005, 12:37:46 PM
I thought our bumpin hobby was op2? lol.  :lol:  
Title: The Bumpy Thread
Post by: coolzero on May 09, 2005, 12:39:31 PM
op2 is a hobby ... bumping isnt :P
Title: The Bumpy Thread
Post by: Sl0vi on May 09, 2005, 07:45:18 PM
For all you bumping Commodore 64 fans out there!

(http://www.c64.com/files/pics/small/b/bumpbugg.gif)

(http://www.c64.com/files/pics/small/b/bumpbugg2.gif)
Title: The Bumpy Thread
Post by: Phantom on May 09, 2005, 07:47:04 PM
Bump
Title: The Bumpy Thread
Post by: Leviathan on May 10, 2005, 12:13:09 AM
op2 is indeed a good hobby..!

man im tiard but thats not uncommon

bump
Title: The Bumpy Thread
Post by: Saibot on May 10, 2005, 02:51:17 AM
bump mapping (バンプマッピング)
(http://www.microsoft.com/japan/msdn/directx/japan/images/bumpma1.gif)
Title: The Bumpy Thread
Post by: Phantom on May 10, 2005, 09:46:22 AM
Hooray for Bump-mapping!
Title: The Bumpy Thread
Post by: Sl0vi on May 10, 2005, 10:54:47 AM
uh oh.... better bump this again
Title: The Bumpy Thread
Post by: Phantom on May 10, 2005, 12:16:51 PM
Bump
Title: The Bumpy Thread
Post by: Saibot on May 11, 2005, 02:11:04 PM
[DoHtml]
<font size=4px>Source: http://masteroni.braunoni.nl/hu.html</font>

<center><OBJECT classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000"
 codebase="http://download.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=5,0,0,0"
 WIDTH=135 HEIGHT=110>

 <PARAM NAME=movie VALUE="http://masteroni.student.utwente.nl/huswf/hu.swf"> <PARAM NAME=quality VALUE=high> <PARAM NAME=bgcolor VALUE=#FFFFFF> <EMBED src="http://masteroni.student.utwente.nl/huswf/hu.swf" quality=high bgcolor=#FFFFFF  WIDTH=135 HEIGHT=110 TYPE="application/x-shockwave-flash" PLUGINSPAGE="http://www.macromedia.com/shockwave/download/index.cgi?P1_Prod_Version=ShockwaveFlash"></EMBED>
</OBJECT>

<small>*espere o som baixar (280kb)</small></center>
<p align=right style=color:#878787;size:1px>bump</p>
<p><B>ACOMPANHE O DIÁLOGO:</B><p>
(Música. Beep.)<p>

Secretary: - Mr. President, Condoleeza Rice is here to see you.

<B>George B.</B> : - Good, send her in.

Secretary: - Yessir.<p>

(Hangs up. Condi enters.)<p>

<B>Condoleeza</B>: - Good morning, Mr. President.


<B>George B.</B> : - Oh Condoleeza, nice to see you. What's happening?

<B>Condoleeza</B> : - Well, Mr. President, I have the report here about the new leader in China.

<B>George B.</B> : - Great, Condi. Lay it on me.

<B>Condoleeza</B> : - Mr. President, Hu is the new leader of China.

<B>George B.</B> : - Well, that's what I want to know.


<B>Condoleeza</B> : - But that's what I'm telling you, Mr. President.

<B>George B.</B> : - Well, that's what I'm asking you, Condie. Who is the new leader of China?

<B>Condoleeza</B> : - Yes.

<B>George B.</B> : - I mean the fellow's name.

<B>Condoleeza</B> : - Hu.


<B>George B.</B> : - The guy in China.

<B>Condoleeza</B> : - Hu.

<B>George B.</B> : - The new leader of China.

<B>Condoleeza</B> : - Hu.

<B>George B.</B> : - The Chinaman!


<B>Condoleeza</B> : - Hu is leading China, Mr. President.

<B>George B.</B> : - Whaddya' asking me for?

<B>Condoleeza</B> : - I'm telling you Hu is leading China.

<B>George B.</B> : - Well, I'm asking you, Condie. Who is leading China?

<B>Condoleeza</B> : - That's the man's name.


<B>George B.</B> : - That's who's name?

<B>Condoleeza</B> : - Yes.<p>

(Pause.)<p>

<B>George B.</B> : - Will you or will you not tell me the name of the new leader of
China?

<B>Condoleeza</B> : - Yes, sir.


<B>George B.</B> : - Yassir? Yassir Arafat is in China? I thought he was in the Middle East.

<B>Condoleeza</B> : - That's correct.

<B>George B.</B> : - Then who is in China?

<B>Condoleeza</B> : - Yes, sir.

<B>George B.</B> : - Yassir is in China?


<B>Condoleeza</B> : - No, sir.

<B>George B.</B> : - Then who is?

<B>Condoleeza</B> : - Yes, sir.

<B>George B.</B> : - Yassir?

<B>Condoleeza</B> : - No, sir.<p>


(Pause. Crumples paper)<p>

<B>George B.</B> : - Condi, you're starting to piss me off now, and it's not 'cause you're black neither. I need to know the name of the new leader of China. So why don't you get me the Secretary General of the United Nations on the phone.

<B>Condoleeza</B> : - Kofi Annan?

<B>George B.</B> : - No, thanks. And Condi, call me George. Stop with that ebonics crap.

<B>Condoleeza</B> : - You want Kofi?


<B>George B.</B> : - No.

<B>Condoleeza</B> : - You don't want Kofi.

<B>George B.</B> : - No. But now that you mention it, I could use a glass of milk.
And then get me the U.N.

<B>Condoleeza</B> : - Yes, sir.

<B>George B.</B> : - Not Yassir! The guy at the United Nations.


<B>Condoleeza</B> : - Kofi?

<B>George B.</B> : - Milk! Will you please make that call?

<B>Condoleeza</B> : - And call who?

<B>George B.</B> : - Well, who is the guy at the U.N?

<B>Condoleeza</B> : - No, Hu is the guy in China.


<B>George B.</B> : - Will you stay out of China?!

<B>Condoleeza</B> : - Yes, sir.

<B>George B.</B> : - And stay out of the Middle East! Just get me the guy at the U.N.

<B>Condoleeza</B> : - Kofi.

<B>George B.</B> : - All right! With cream and two sugars. Now get on the phone.<p>

(Condi picks up the phone.)<p>

<B>Condoleeza</B> : - Hello. Rice, here.

<B>George B.</B> : - Rice? Good idea. And get a couple of egg rolls, too, Condi. Maybe we should
send some to the guy in China. And the Middle East. Can you get chinese food in the Middle East? I don't know.<p>

(Door slam. Música.)<p>

*Thanks to João Madureira & CAT


<font size=4px>Source: http://masteroni.braunoni.nl/hu.html</font>
[/DoHtml]
Title: The Bumpy Thread
Post by: Betaray on May 11, 2005, 06:42:14 PM
wtbumpingf

lol
Title: The Bumpy Thread
Post by: Phantom on May 11, 2005, 07:58:39 PM
lol, I have to admit, that was a good parody of the "Who's on first" skit. lol bump
Title: The Bumpy Thread
Post by: ArchÂngel on May 12, 2005, 03:22:35 AM
...  Wow, ok i did have a big ASCII bump, but the forums dont seem to like that kind of creativity.... oh well..
BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP
BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP
BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP
BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP
BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP
BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP  
 
Title: The Bumpy Thread
Post by: Leviathan on May 12, 2005, 03:59:14 AM
Bump

Saibot post comedy like that in a seprate thread.

This test and spam forum is for whatevea. So go ahead ArchÂngel.
Title: The Bumpy Thread
Post by: ArchÂngel on May 12, 2005, 04:05:38 AM
Heh, what i meant was that i cant remember the code for inserting a space, and the postings remove anything longer than 1 space..  If someone could remind me of the code for a space, i could quickly edit the bump ; )
Title: The Bumpy Thread
Post by: Saibot on May 12, 2005, 06:08:19 AM
Try
Code: [Select]
[DoHtml]<pre>bump-image</pre>[/DoHtml]
Likea this:
[DoHtml]
<center>
01 2  3   4    5     6      7       8        9         |         9        8      7      6     5    4   3  2 10


<hr width=25%>
Or
<hr width=25%>

<div style=font-size:100px>0</div><div style=font-size:90px>1</div> <div style=font-size:80px>2</div>  <div style=font-size:70px>3</div>   <div style=font-size:60px>4</div>    <div style=font-size:50px>5</div>     <div style=font-size:40px>6</div>      <div style=font-size:30px>7</div>       <div style=font-size:20px>8</div>        <div style=font-size:10px>9</div>         <div style=font-size:3px>|</div>         <div style=font-size:10px>9</div>        <div style=font-size:20px>8</div>      <div style=font-size:30px>7</div>      <div style=font-size:40px>6</div>     <div style=font-size:50px>5</div>    <div style=font-size:60px>4</div>   <div style=font-size:70px>3</div>  <div style=font-size:80px>2</div> <div style=font-size:90px>1</div><div style=font-size:100px>0</div>


<font color=#878787>Oh Crap! Max font size is 6px?</font>
<dl>
<dr><font color=#788787>Edit:</font>
<dd><font color=#878778>Oh, thank you Eddy-B, didn't know that div style worked and not font size and sapn style.... hehe</font>
</dl>

</center>
[/DoHtml]
Title: The Bumpy Thread
Post by: Leviathan on May 12, 2005, 06:20:36 AM
Ah yes... html is enabled in this forum.

bumpy ¬¬~~
Title: The Bumpy Thread
Post by: xamlit on May 12, 2005, 11:06:39 AM
The bump to the shizump!
Title: The Bumpy Thread
Post by: Phantom on May 12, 2005, 09:31:13 PM
Bump
Title: The Bumpy Thread
Post by: Saibot on May 13, 2005, 06:56:30 AM
What's "shizump"?

&&bump
Title: The Bumpy Thread
Post by: Phantom on May 13, 2005, 07:05:42 AM
bump=bump&
Title: The Bumpy Thread
Post by: Sl0vi on May 13, 2005, 01:55:33 PM
bump
Title: The Bumpy Thread
Post by: Phantom on May 13, 2005, 04:10:56 PM
bump
Title: The Bumpy Thread
Post by: ArchÂngel on May 13, 2005, 07:06:58 PM
[DoHtml]


BUMPBUM   PBU    MPB  UMP      BUM  PBUMPBU
MPB  UMP  BUM    PBU  MP B    U MP  BU   MPB
UMPBUM    PBU    MPB  UM   PB   UM  PBUMPBU
MPB  UMP  BUM    PBU  MP        BU  MPB
UMPBUMP    BUMPBUMP   BU        MP  BUM          P



             BUMP          BUMP
             BUMP          BUMP
                                               
                                         
     BUMPBU                     MPBUMP
       BUMPBUMPBUMPBUMPBUMPBUMPBUMPB
           BUMPBUMPBUMPBUMPBUMP


(Can you tell I get bored easily?)
[/DoHtml]
Title: The Bumpy Thread
Post by: Saibot on May 14, 2005, 02:27:59 AM
Not at much as I do.... remember my "pinic bump" with the pre-drawed pinic tabel? It's prue fun! And magnificent bump u come up with!

[dohtml]<span onclick="javascript:alert('FIX EM BACK!')">Why did you delete all my bump asci-grafics!?!?!?!?!?!?!?!?!?! They are gonn with the old bump-thread!</span>[/dohtml]
Title: The Bumpy Thread
Post by: Eddy-B on May 14, 2005, 05:14:29 AM
Quote
bump
This post has been edited by Sl0vi on May 13 2005, 10:56 PM
Did you misspell "BUMP" ?

Quote
Oh Crap! Max font size is 6px?


[DoHtml]<div style="font-size:120pt">No,it isn't</div>[/DoHtml]



 
Title: The Bumpy Thread
Post by: Saibot on May 18, 2005, 01:15:49 AM
[DoHtml]<table border=1 cellpadding=0 cellsapcing=0 bgcolor=#000000 width=100%><tr><td>



<div style=font-size:100px;color:#999999>I cannot hear you</div>



<center><div style=font-size:75px;color:#FFFFFF>, Eddy-B;</div></center>







<div style=font-size:230px;z-index:99;color:#ffccde;align:right>Speak</div>
<div style=font-size:7px;color:#003300;z-index:102><center> bump</center></div>






<div style=font-size:260px;z-index:100;color:#deccff>Louder!</div>
<div style=font-size:10px;z-index:101;color:#99aa99><center>Thank you, Eddy-b</center></div>





</tr></td></table>[/DoHtml]
Title: The Bumpy Thread
Post by: Leviathan on May 18, 2005, 02:17:45 AM
bump
Title: The Bumpy Thread
Post by: Freeza-CII on May 18, 2005, 04:23:28 AM
(http://www.freeza.outpostuniverse.net/images/BUMP.JPG)
Title: The Bumpy Thread
Post by: zigzagjoe on May 18, 2005, 06:20:18 AM
Freeza: you have no life. (j/k)


bump

 :I'm with stupid:  
 
Title: The Bumpy Thread
Post by: Sl0vi on May 18, 2005, 04:15:56 PM
you're bump !?!
Title: The Bumpy Thread
Post by: Phantom on May 18, 2005, 06:01:28 PM
Bump
Title: The Bumpy Thread
Post by: Saibot on May 19, 2005, 06:42:22 AM
[DoHtml]
<table border=0 cellpading=0 cellsapcing=0 width=500 height=236 background="http://www.bold.se/forum/attachment.php?attachmentid=578"><tr><td valign=top>
<center><font color=orange>
<span style=font-size:8px><font color=#88cc00>Konichiwa</font> is the name of Robyn's new
</font>
<sapn style=font-size:12px;color=orange><font color=orange>record:</font> <a href="http://www.robyn.com/" style=color:#cc8800>www.robyn.com[/url]


<span style=font-size:9px;color:brown>Konichiwa means 'How are you'?</font>










<font color=#e0e0e0>bump</font>
</font></center>
</td></tr></table>
[/DoHtml]
Title: The Bumpy Thread
Post by: Sl0vi on May 20, 2005, 04:23:17 PM
oh... bump!
Title: The Bumpy Thread
Post by: Phantom on May 20, 2005, 08:32:36 PM
bump
Title: The Bumpy Thread
Post by: plymoth45 on May 22, 2005, 11:52:06 AM
spam spam spam spam spam spam spam errr i mean bump bump bump bump bump bump
Title: The Bumpy Thread
Post by: Sl0vi on May 22, 2005, 01:31:42 PM
bump?
Title: The Bumpy Thread
Post by: Saibot on May 22, 2005, 11:35:44 PM
[DoHtml]
<table summary="An outpost 2 message likely bump message" title="Outpost 2-message bump" width=352 height=156 border=1 bgcolor=#00002a cellspacing=0 cellpadding=0>
<tr height=25 bordercolor=red>
  <td><center><div style=color:#00ff00;font-size:16px>OUTPOST 2</div></center></td>
</tr>
<tr height=65 bordercolor=#00002a bordercolordark=#00002a bordercolorlight=#00002a>
  <td><div style=color:#00ff00;font-size:14px><center>A bump has caused an serious error which
 does match our sence of humor.</center></div></td>
</tr>
<tr bordercolor=#00002a bordercolordark=#00002a bordercolorlight=red>
  <td>
    <center><table border=1 style=color:yellow;font-size:12px;background-color:#000000;width:140px;height:25px bordercolor=#00002a><tr bordercolor=#990000><td><center><font color=yellow>OK</font></center></td></tr></table></center>
   </td>
</tr>
</table>


<p>


<font color=#449900>[censorship] it. It seems to only render correct in IE, ):!</font>
[/DoHtml]
Title: The Bumpy Thread
Post by: plymoth45 on May 24, 2005, 08:29:22 PM
looks right in my bumping firefox (Somewhat)
Title: The Bumpy Thread
Post by: Leviathan on May 25, 2005, 01:32:40 AM
bumpy
Title: The Bumpy Thread
Post by: Saibot on May 25, 2005, 01:36:26 PM
AH!

http://linux.isthes***.net/: (http://linux.isthes***.net/:)
[img]http://linux.isthes***.net/[img]


bump... omg... omg... omg... hahahahaha... I just love censorship...
For you that don't bump understand... the link to linux.isthes***.net image has been broken due to censorship....


Conclution: [dohtml](http://censorship.isthes***.net/)[/dohtml]
Title: The Bumpy Thread
Post by: plymoth45 on May 26, 2005, 04:40:53 PM
bump it!
Title: The Bumpy Thread
Post by: Sl0vi on May 26, 2005, 05:43:14 PM
woohoo! I got on forums!

Bump to you all!
Title: The Bumpy Thread
Post by: ArchÂngel on May 26, 2005, 10:20:49 PM
its too bumpin bad i cant bumpin work java into this bumpin thread, i had a bumpin good bump to bump.

 :CK9's:   <= bumped
Title: The Bumpy Thread
Post by: plymoth45 on May 27, 2005, 06:51:27 AM
hey, ck9 bump!
Title: The Bumpy Thread
Post by: spirit1flyer on May 27, 2005, 05:59:17 PM
a bump from Oregon
Title: The Bumpy Thread
Post by: plymoth45 on May 28, 2005, 12:50:44 PM
hey, spirit bump, where ahve you been?
Title: The Bumpy Thread
Post by: CK9 on May 29, 2005, 01:54:44 PM
bump
Title: The Bumpy Thread
Post by: Sl0vi on May 30, 2005, 04:55:41 PM
the bumpy thread has been bumped to a sub-forum!!!!!
Title: The Bumpy Thread
Post by: Tellaris on May 31, 2005, 01:20:54 AM
That certainly is quite the bump.
Title: The Bumpy Thread
Post by: Sl0vi on May 31, 2005, 04:39:13 PM
it's a sucky bump!
Title: The Bumpy Thread
Post by: Saibot on June 02, 2005, 06:10:21 AM
This is a NO DOHTML IS GONE bump
Title: The Bumpy Thread
Post by: CK9 on June 02, 2005, 06:42:58 AM
bumperific
Title: The Bumpy Thread
Post by: Saibot on June 03, 2005, 04:22:38 PM
2097147 bumps on you.
 
Title: The Bumpy Thread
Post by: CK9 on June 04, 2005, 08:58:48 AM
2097147 bumps on the wall, 2097147 bumps, you take one down, pass it around, 2097146 bumps on the wall
Title: The Bumpy Thread
Post by: Betaray on June 04, 2005, 07:44:36 PM
why dont you just take all of them down and get all BUMPED up!!
Title: The Bumpy Thread
Post by: plymoth45 on June 04, 2005, 10:22:44 PM
i would rather get high then bumped up :P
Title: The Bumpy Thread
Post by: Saibot on June 06, 2005, 02:43:12 AM
A bump outpost once said: Look at that bump walking over there! we most erase him from the graduated of bumpers!
Title: The Bumpy Thread
Post by: Leviathan on June 06, 2005, 05:25:56 AM
Saibot y dont u post a topic about op2 sometime lol??

bump¬
Title: The Bumpy Thread
Post by: thablkpanda on June 08, 2005, 09:34:15 AM
01100010011101010110110101110000

Did someone already use that one?

 
Title: The Bumpy Thread
Post by: Mez on June 08, 2005, 11:27:54 AM
bump
 
Title: The Bumpy Thread
Post by: Betaray on June 08, 2005, 12:20:06 PM
hay, what ever happoned to the "you know when you played too much op2 when" threads, we had over 500 of them, and they were really funny

btw bump
Title: The Bumpy Thread
Post by: Hooman on June 08, 2005, 04:04:15 PM
You mean, "you've ever played the weakest lynx"?

Bump.
 
Title: The Bumpy Thread
Post by: Sl0vi on June 08, 2005, 04:54:32 PM
bump
Title: The Bumpy Thread
Post by: thablkpanda on June 08, 2005, 06:01:44 PM
010101110110100001100001011101000010000001110100011010000110010100100000011010000110010101101100011011000010110000100000011110010110000100100111011011000110110000100000011001000110100101100100011011100010011101110100001000000110110001101001011010110110010100100000011011010111100100100000011001010110011001100110011010010110111000100000011000100110100101101110011000010111001001111001001000000110001001110101011011010111000000100001000011010000101000001101000010100101000001100001011011100110010001100001
Title: The Bumpy Thread
Post by: Saibot on June 09, 2005, 10:17:17 AM
You just said: "What ad", thablkpanda?

I say you:
"66 117 109 112 32 121 111 117 32 109 114 32 110 48 48 98 32 116 104 97 98 108 107 112 97 110 100 97 46 0 89 110 99 101 32 121 111 117 99 107 46 32 79 112 115 32 110 111 119 32 73 32 115 117 99 107 32 116 111 111 44 32 104 101 104 101 32 58 41 46", in decimal.
Title: The Bumpy Thread
Post by: thablkpanda on June 09, 2005, 07:22:20 PM
Uhhh, homie, I was in binary. I haven't the freakiest idea about decimal. I said, alot of shizit in binary, I didn't kno that was actually something in decimal.
Title: The Bumpy Thread
Post by: Saibot on June 10, 2005, 02:46:23 AM
How cool! You just type something, and it creates 2 words. Well, where's your bump them? :P. Main is in the decimal numbers.
Title: The Bumpy Thread
Post by: CK9 on June 10, 2005, 06:37:06 AM
WARNING! All posts in this thread must contain bump.  If the letters are seperate, the must be bolded/underlined/or something that makes them stand out.
Title: The Bumpy Thread
Post by: Sl0vi on June 10, 2005, 10:29:14 AM
the bumpy thread is ruined! :( full of bumpless posts!
Title: The Bumpy Thread
Post by: CK9 on June 10, 2005, 10:14:50 PM
we can bumping save it!
Title: The Bumpy Thread
Post by: Saibot on June 15, 2005, 05:58:49 AM
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
bumpbumpbumpbump
Title: The Bumpy Thread
Post by: Leviathan on June 15, 2005, 07:24:20 AM
Quote
hay, what ever happoned to the "you know when you played too much op2 when" threads, we had over 500 of them, and they were really funny
Beta: outpostuniverse.net/op2txt/tmw.php (http://www.outpostuniverse.net/op2txt/tmw.php)

bump >_>
Title: The Bumpy Thread
Post by: CK9 on June 15, 2005, 08:09:52 AM
bump
Title: The Bumpy Thread
Post by: Saibot on June 15, 2005, 04:20:40 PM
Inside cleaning (http://www.grineflip.dk/funstuff/indvendig_rensning.htm) Hahahaha!

It says:


Your screen are just now being cleaned inside

<Image>

Bump
Title: The Bumpy Thread
Post by: Sl0vi on June 16, 2005, 03:20:55 AM
but those posts up there still have no bump!!!!!
Title: The Bumpy Thread
Post by: cycletronic on June 16, 2005, 08:32:28 AM
Anyone have a bump on their forehead?
Title: The Bumpy Thread
Post by: CK9 on June 16, 2005, 11:35:10 AM
every bumping member will :heh:
Title: The Bumpy Thread
Post by: plymoth45 on June 16, 2005, 05:18:13 PM
:CK9's:

ck has a bump on his head lol
Title: The Bumpy Thread
Post by: CK9 on June 16, 2005, 06:52:16 PM
That's my bumping smiley!
Title: The Bumpy Thread
Post by: plymoth45 on June 16, 2005, 10:08:29 PM
yes it bumping is!
Title: The Bumpy Thread
Post by: cycletronic on June 16, 2005, 10:31:22 PM
ba-bump Bump BUMP!
Title: The Bumpy Thread
Post by: Eddy-B on June 17, 2005, 08:24:11 AM
bum-py  
Title: The Bumpy Thread
Post by: CK9 on June 17, 2005, 11:58:27 AM
:CK9's::CK9's::CK9's::CK9's::CK9's::CK9's::CK9's::CK9's::CK9's::CK9's::CK9's::CK9's::CK9's:

my bumping attack!  (If you look at the smiley code, you'll see that it is my [favorite] smiley)
Title: The Bumpy Thread
Post by: Saibot on June 17, 2005, 03:29:12 PM
Omg, how cool with
Code: [Select]
:CK9's:
. How do I make my own bump smile?
Title: The Bumpy Thread
Post by: plymoth45 on June 17, 2005, 07:37:58 PM
ok, the war of ck has bumped lol

:CK9's:
:CK9's:
:CK9's:
:CK9's:
:CK9's:
:CK9's:
:CK9's:
:CK9's:
:CK9's:
:CK9's:
:CK9's:
:CK9's:
:CK9's:
:CK9's:
:CK9's:
:CK9's:
:CK9's:





 
Title: The Bumpy Thread
Post by: CK9 on June 18, 2005, 03:30:52 PM
do you bumping realize I'm always the one with the mallet?


 :CK9's: @ :plymoth:  
Title: The Bumpy Thread
Post by: plymoth45 on June 19, 2005, 12:11:54 AM
:plymoth: = :plymoth: having mallet in :CK9's:
Title: The Bumpy Thread
Post by: CK9 on June 19, 2005, 09:05:59 AM
YOU FORGOT TO BUMP!  thus your claim is invalid :P
Title: The Bumpy Thread
Post by: Saibot on June 19, 2005, 09:40:19 AM
plymoth45 forgot to bump.
Title: The Bumpy Thread
Post by: CK9 on June 19, 2005, 09:46:36 AM
should I bump him?
Title: The Bumpy Thread
Post by: Sl0vi on June 19, 2005, 11:29:57 AM
FFS! There are like 3 posts in this thread without bumps now!!!

It's all going down the drain! :'(  
Title: The Bumpy Thread
Post by: CK9 on June 19, 2005, 12:54:39 PM
there's more than 3 bumpless  posts.
Title: The Bumpy Thread
Post by: Sl0vi on June 19, 2005, 03:27:16 PM
yes.. why do people do that... ruin perfectly good bumpy threads :(

If you don't know how to bump! then please stay away from bumpy threads!
Title: The Bumpy Thread
Post by: CK9 on June 19, 2005, 05:48:08 PM
BUMP YEAH!
Title: The Bumpy Thread
Post by: BlackBox on June 21, 2005, 05:58:44 AM
Bumping dumbbumps!

Saibot: ask me or Lev if you want a smiley added like CK9 used back there.

BUMP
Title: The Bumpy Thread
Post by: Leviathan on June 21, 2005, 07:28:48 AM
bump
Title: The Bumpy Thread
Post by: CK9 on June 21, 2005, 11:15:21 AM
Attack f the Killer Bumps
Title: The Bumpy Thread
Post by: Mez on June 22, 2005, 02:46:51 PM
bump bump
Title: The Bumpy Thread
Post by: Saibot on June 22, 2005, 05:40:43 PM
(http://images.animanga.nu/fanart/3206/bump.gif)
If a piturce don't counts: bump.
Title: The Bumpy Thread
Post by: CK9 on June 22, 2005, 06:02:11 PM
pics don't bumping count, lol
Title: The Bumpy Thread
Post by: BlackBox on June 22, 2005, 06:18:30 PM
f***ing bumping !
Title: The Bumpy Thread
Post by: plymoth45 on June 22, 2005, 07:05:39 PM
oh bump
Title: The Bumpy Thread
Post by: CK9 on June 22, 2005, 07:08:47 PM
bump off  
Title: The Bumpy Thread
Post by: Sl0vi on June 23, 2005, 02:55:45 AM
bump
Title: The Bumpy Thread
Post by: CK9 on June 23, 2005, 12:13:39 PM
Why doesn't the bumping /me command work here?
Title: The Bumpy Thread
Post by: Sl0vi on June 24, 2005, 03:43:31 AM
because it is meant for bumping IRC?
Title: The Bumpy Thread
Post by: plymoth45 on June 24, 2005, 09:52:56 PM
because the bumping /me command was removed long ago from this forum :'(
Title: The Bumpy Thread
Post by: CK9 on June 25, 2005, 11:36:23 AM
That's bumping wrong to do!
Title: The Bumpy Thread
Post by: plymoth45 on July 04, 2005, 06:55:03 PM
to bump, or not to bump, that is the bump!
Title: The Bumpy Thread
Post by: CK9 on July 04, 2005, 08:59:02 PM
bump
Title: The Bumpy Thread
Post by: Sl0vi on July 05, 2005, 02:39:14 AM
Bump!?!?
Title: The Bumpy Thread
Post by: plymoth45 on July 09, 2005, 01:59:26 AM
bump, just a bump
Title: The Bumpy Thread
Post by: CK9 on July 09, 2005, 11:39:30 AM
bump
Title: The Bumpy Thread
Post by: plymoth45 on July 10, 2005, 02:12:35 AM
the bump will never again reach 100 pages of bump :'(
Title: The Bumpy Thread
Post by: CK9 on July 10, 2005, 12:38:23 PM
xfir's bump thread is getting close...
Title: The Bumpy Thread
Post by: Saibot on July 10, 2005, 06:12:04 PM
Yes, I usually don't bump here anymore due to the inactivation of HTML-code for user posts.
Title: The Bumpy Thread
Post by: Sl0vi on July 11, 2005, 02:47:03 AM
turn on the BUMP!
Title: The Bumpy Thread
Post by: plymoth45 on July 11, 2005, 03:11:49 PM
bump
Title: The Bumpy Thread
Post by: CK9 on July 13, 2005, 08:34:16 AM
sneeze bump
Title: The Bumpy Thread
Post by: zigzagjoe on July 13, 2005, 01:27:06 PM
[doHTML]
<marquee behavior= scroll; direction= left;  height=12;  ><span style='font-family: verdana, arial, sans-serif; color: red; font-size: 100%'>HTML does work....see? =) oh ya, BUMP!!!</span></marquee>
[/doHTML]

=D
Title: The Bumpy Thread
Post by: CK9 on July 13, 2005, 01:31:40 PM
bump
Title: The Bumpy Thread
Post by: Sl0vi on July 14, 2005, 03:39:18 AM
[doHTML]
<INPUT VALUE="bump" TYPE="button" OnClick="parent.location'http://forum.outpostuniverse.net/index.php?act=Post&CODE=02&f=51&t=1427'">
[/doHTML]
Title: The Bumpy Thread
Post by: BlackBox on July 14, 2005, 05:53:16 AM
[doHTML]<form action="http://outpostuniverse.net/" name="fdafdafd"><button>(http://forum.outpostuniverse.net/style_images/BoHeGeHa-092/logo4.gif)

<font color="green">BUMP</font><font color="red"> I</font><font color="blue"> TELL</font><font color="yellow"> YA!</font></button></form>[/doHTML]

Yes, it's a button.  ;)  
Title: The Bumpy Thread
Post by: CK9 on July 14, 2005, 09:38:17 AM
[doHTML]
<a href="http://www.xfir.net/ck9/bump.html" target="_blank">bump[/url]
[/doHTML]
 
Title: The Bumpy Thread
Post by: plymoth45 on July 16, 2005, 02:25:41 AM
a good ole link bump lol
Title: The Bumpy Thread
Post by: CK9 on July 18, 2005, 01:21:46 PM
tired of bumps that go nowhere
Title: The Bumpy Thread
Post by: Betaray on July 18, 2005, 03:04:37 PM
like this bump
Title: The Bumpy Thread
Post by: Sl0vi on July 19, 2005, 02:26:22 AM
a bump?
Title: The Bumpy Thread
Post by: CK9 on July 19, 2005, 11:15:45 AM
a bump to your haed
*pulls out a hammer*
Title: The Bumpy Thread
Post by: Betaray on July 20, 2005, 12:06:25 PM
bump to the bump
Title: The Bumpy Thread
Post by: CK9 on July 25, 2005, 10:41:24 PM
Beta posted, free bumps all around!
Title: The Bumpy Thread
Post by: plymoth45 on July 28, 2005, 10:53:49 PM
*Takes a bump and starts a bump fight*
Title: The Bumpy Thread
Post by: Stormy on July 29, 2005, 11:31:01 PM
BBBBBBBBBBBBBB
UUUUUUUUUUUU
MMMMMMMMMMM
PPPPPPPPPPPPPP
YOURSELF  :P  :P  :P  :P

 :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:
[OT]  :evil laugh:  [OT]
 
Title: The Bumpy Thread
Post by: CK9 on July 30, 2005, 02:41:45 AM
nice bump smiley
Title: The Bumpy Thread
Post by: Stormy on July 30, 2005, 09:29:34 AM
Thanks... *BUMP*  :bump:  :evil laugh:  :bump:  :whistle:
 :x:  
Title: The Bumpy Thread
Post by: Voyager7456 on July 30, 2005, 10:52:03 AM
:anibump:

Bump. I like that smiley.
Title: The Bumpy Thread
Post by: Sl0vi on July 30, 2005, 06:50:21 PM
yes that is a nice bump
Title: The Bumpy Thread
Post by: CK9 on July 31, 2005, 09:48:52 AM
bump
Title: The Bumpy Thread
Post by: plymoth45 on August 02, 2005, 12:24:44 AM
[doHTML]
<div align="left">
<z><embed src="http://plymoth45.outpostuniverse.net/misc/Promy Explosion 02.WMV" width="400" height="300"></embed></z>
</div>
[/doHTML]

What a bump :P
Title: The Bumpy Thread
Post by: Tellaris on August 02, 2005, 12:37:41 AM
What star trek game is that?
oh, and bump I guess.
Title: The Bumpy Thread
Post by: CK9 on August 02, 2005, 07:10:13 AM
bump  was that a win or a loose?
Title: The Bumpy Thread
Post by: plymoth45 on August 02, 2005, 08:43:13 AM
That is star trek bridge commander, and that was a win, I just self-destructed after the battle lol

bump
Title: The Bumpy Thread
Post by: zigzagjoe on August 02, 2005, 09:17:56 AM
[doHTML]
German Engineering vs. Arab Technology
<Br>

<embed src="http://zigzagjoe.no-ip.com/germanarabtech203.wmv" width=320 height=240></embed>
[/doHTML]
they got rid of it.....but i saved it :D

looool bump
Title: The Bumpy Thread
Post by: CK9 on August 02, 2005, 02:38:26 PM
bump
Title: The Bumpy Thread
Post by: Stormy on August 02, 2005, 05:14:40 PM
ROFL NICE ONE ZIGGY LOL

can you upload it somewhere so i can get a copy?

oh no.. *BUMP*
/me flies up and hits his head on the celing....
Ow, theres a  :bump: on my head...
Title: The Bumpy Thread
Post by: OP2Patriot on August 02, 2005, 05:23:26 PM
bump
Title: The Bumpy Thread
Post by: plymoth45 on August 02, 2005, 09:36:24 PM
rotfl, bump
Title: The Bumpy Thread
Post by: CK9 on August 03, 2005, 07:27:36 AM
PHIL POSTED!  MORE FREE BUMPS FOR EVERYONE :D
Title: The Bumpy Thread
Post by: zigzagjoe on August 03, 2005, 12:19:26 PM
phils back alive and bumping again! :D
Title: The Bumpy Thread
Post by: Stormy on August 03, 2005, 12:39:47 PM
Dun DUn DUN!!!!! BUMP!!!!!!!!!!!!!!!!!!!!!!!!!
Title: The Bumpy Thread
Post by: CK9 on August 03, 2005, 01:02:08 PM
forumites returning bump
Title: The Bumpy Thread
Post by: xamlit on August 03, 2005, 06:45:46 PM
Bumpers?
 
Title: The Bumpy Thread
Post by: Tellaris on August 03, 2005, 08:48:51 PM
heh, I found it first for you to save, Ziggy!
Bumpetity
Title: The Bumpy Thread
Post by: Stormy on August 03, 2005, 10:28:58 PM
OMG OP2 Patriot is BAAKKKKK!!!!!!!!!!!!!!!!
bu bu BUMP!!! ON MY HEAD!!!!!!!! OWWIE :bump:  
Title: The Bumpy Thread
Post by: CK9 on August 04, 2005, 07:30:40 AM
potatos potatos potatos potatos bump
Title: The Bumpy Thread
Post by: Stormy on August 05, 2005, 01:01:05 AM
badger badger badger badger badger badger badger badger badger badger badger badger... a BUmpy BUMP BUMP!!!
Title: The Bumpy Thread
Post by: Sl0vi on August 05, 2005, 03:56:04 AM
bump
Title: The Bumpy Thread
Post by: Stormy on August 05, 2005, 01:19:22 PM
BBBBBBBBBBBBBBBBBB
UUUUUUUUUUUUUUUUUU
MMMMMMMMMMMMMMMM
PPPPPPPPPPPPPPPPPPPPP
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
the BUMPY SONG!! the BUMPY SONG!!!! SING ALONG IF YOU KNOW THE BUMP..IE SONG!!!!!!!!!!
Title: The Bumpy Thread
Post by: CK9 on August 05, 2005, 02:39:06 PM
bumps for change
Title: The Bumpy Thread
Post by: Stormy on August 07, 2005, 08:30:17 PM
Bumps for Chickens, anyone? :lol:  
Title: The Bumpy Thread
Post by: CK9 on August 08, 2005, 01:11:46 AM
where's beta bump?
Title: The Bumpy Thread
Post by: BlackBox on August 08, 2005, 05:22:30 AM
double bumper!
Title: The Bumpy Thread
Post by: Stormy on August 08, 2005, 11:13:06 AM
BUMPS UP FOR SALE!!!!!! ONLY $100  :lol:  
Title: The Bumpy Thread
Post by: CK9 on August 08, 2005, 12:10:06 PM
bumps
Title: The Bumpy Thread
Post by: Sl0vi on August 08, 2005, 12:19:43 PM
bump
Title: The Bumpy Thread
Post by: Mez on August 08, 2005, 01:40:31 PM
bump
Title: The Bumpy Thread
Post by: CK9 on August 08, 2005, 03:43:17 PM
bump
Title: The Bumpy Thread
Post by: zigzagjoe on August 08, 2005, 04:24:13 PM
say something bump it!
Title: The Bumpy Thread
Post by: CK9 on August 08, 2005, 06:57:48 PM
okay:  the bumping 18th b-day in the US sux...
Title: The Bumpy Thread
Post by: Stormy on August 08, 2005, 08:39:41 PM
the bumping cars in the parking lot like to bump into your bumper  
Title: The Bumpy Thread
Post by: CK9 on August 09, 2005, 09:14:21 PM
I'm trying to decide 3 more bumping songs to use my 5 free downloads on
Title: The Bumpy Thread
Post by: plymoth45 on August 10, 2005, 01:05:44 AM
bump!
Title: The Bumpy Thread
Post by: CK9 on August 10, 2005, 11:41:00 AM
down to 2 bumps, and I think I made some good decisions so far
Title: The Bumpy Thread
Post by: plymoth45 on August 11, 2005, 11:29:58 PM
bump
Title: The Bumpy Thread
Post by: CK9 on August 12, 2005, 12:17:09 AM
stealth bump
Title: The Bumpy Thread
Post by: Sl0vi on August 12, 2005, 02:47:22 AM
just another regular bump
Title: The Bumpy Thread
Post by: CK9 on August 12, 2005, 11:00:09 AM
bumpo
Title: The Bumpy Thread
Post by: instigator on August 12, 2005, 08:39:39 PM
I out bump all of you!!!
Title: The Bumpy Thread
Post by: plymoth45 on August 12, 2005, 10:46:34 PM
you bump?
Title: The Bumpy Thread
Post by: CK9 on August 12, 2005, 11:12:20 PM
bump
Title: The Bumpy Thread
Post by: instigator on August 13, 2005, 06:41:55 AM
This is a really bumpy thread  :lol:
Title: The Bumpy Thread
Post by: zigzagjoe on August 13, 2005, 08:16:23 AM
hungry bump
Title: The Bumpy Thread
Post by: CK9 on August 13, 2005, 11:17:15 AM
NOT ANOTHER BUMPING DANCING BANANA!
Title: The Bumpy Thread
Post by: Sl0vi on August 14, 2005, 07:48:55 AM
bump
Title: The Bumpy Thread
Post by: CK9 on August 14, 2005, 09:42:56 AM
bump
Title: The Bumpy Thread
Post by: Stormy on August 17, 2005, 08:17:28 PM
(in a movie studio)
(orchestra plays) dun DUn DUN!!! *BUMP* OW!!!!!, you killed my line with that mic over my head, don't swing that thing like that.....

BUMP!
Title: The Bumpy Thread
Post by: CK9 on August 17, 2005, 09:13:03 PM
Oh my *bump*!  You killed Kenny!

You *bump*!
Title: The Bumpy Thread
Post by: Mez on August 18, 2005, 08:03:19 AM
oh my god you killed kenny you bumpstard
Title: The Bumpy Thread
Post by: instigator on August 18, 2005, 08:20:38 AM
hahaha! that was funny

watch out for the bumper :unsure:
Title: The Bumpy Thread
Post by: CK9 on August 18, 2005, 11:31:08 AM
bumpit cartman!
Title: The Bumpy Thread
Post by: Mez on August 19, 2005, 03:57:26 PM
wat the bump are you doing cartman, are bumping crazy?
Title: The Bumpy Thread
Post by: coolzero on August 20, 2005, 04:33:03 AM
BUMP ( CLICK ON IT )  (http://coolzero.outpostuniverse.net/BUMP.txt)  B)
Title: The Bumpy Thread
Post by: Mez on August 20, 2005, 06:37:12 AM
bump
Title: The Bumpy Thread
Post by: Eddy-B on August 20, 2005, 07:04:33 AM
DUMP .. err. i mean BUMP
Title: The Bumpy Thread
Post by: Sl0vi on August 21, 2005, 04:48:33 PM
bump?
Title: The Bumpy Thread
Post by: plymoth45 on August 23, 2005, 10:08:50 AM
The bump hath slowed from what it used to be :(
Title: The Bumpy Thread
Post by: CK9 on August 24, 2005, 11:07:21 AM
bump
 
Title: The Bumpy Thread
Post by: Sl0vi on August 24, 2005, 02:35:00 PM
speed bump
Title: The Bumpy Thread
Post by: instigator on August 24, 2005, 02:36:54 PM
hmm well there are 14 pages on here with 300 replies, not bad.  We just need more people bumping....
Title: The Bumpy Thread
Post by: BlackBox on August 24, 2005, 04:14:10 PM
coolzero: Post deleted. Sexually-explicit language is not allowed on the forums, sorry.

(http://www.outpostuniverse.net/hacker/bump.jpg)

BUMP!

(And yes, I coded it, not lining up a bunch of units like many people might think. DLL available here: http://www.outpostuniverse.net/hacker/tBump.dll (http://www.outpostuniverse.net/hacker/tBump.dll). Place into OP2 folder, run the new tutorial, and watch the center of the map for explosions)
Title: The Bumpy Thread
Post by: plymoth45 on August 25, 2005, 12:14:29 PM
bump
Title: The Bumpy Thread
Post by: coolzero on August 25, 2005, 03:13:46 PM
srry for the "Sexually-explicit language"
and nice bump hacker  :lol:

bump
Title: The Bumpy Thread
Post by: CK9 on August 26, 2005, 12:03:32 PM
bump
Title: The Bumpy Thread
Post by: plymoth45 on August 27, 2005, 12:00:13 AM
ZZZZzzzz bump
Title: The Bumpy Thread
Post by: CK9 on August 27, 2005, 09:39:22 AM
bump
Title: The Bumpy Thread
Post by: Mez on August 28, 2005, 11:57:12 AM
bump
Title: The Bumpy Thread
Post by: Stormy on August 28, 2005, 12:20:12 PM
bump
Title: The Bumpy Thread
Post by: zanco on August 28, 2005, 04:32:47 PM
NOT Bump
!Bump
 
Title: The Bumpy Thread
Post by: plymoth45 on August 28, 2005, 09:02:29 PM
bump
Title: The Bumpy Thread
Post by: Stormy on August 29, 2005, 03:48:14 PM
bump
Title: The Bumpy Thread
Post by: Sl0vi on August 30, 2005, 06:22:13 PM
bump
Title: The Bumpy Thread
Post by: zanco on August 31, 2005, 05:19:42 PM
:anibump:  
Title: The Bumpy Thread
Post by: Stormy on August 31, 2005, 05:20:21 PM
bump
Title: The Bumpy Thread
Post by: plymoth45 on September 01, 2005, 09:12:06 PM
the thunk to bump
Title: The Bumpy Thread
Post by: Sl0vi on September 02, 2005, 07:39:46 PM
bump
Title: The Bumpy Thread
Post by: instigator on September 02, 2005, 08:56:12 PM
whats up with all these one word bumps!? we need more content ppl so bump it!
 
Title: The Bumpy Thread
Post by: CK9 on September 03, 2005, 05:11:29 AM
*groan!*  no more bumping attempts at wiccan candle spell things!
Title: The Bumpy Thread
Post by: plymoth45 on September 05, 2005, 12:25:55 AM
then bump is dying :'(
Title: The Bumpy Thread
Post by: Stormy on September 05, 2005, 08:39:54 PM
Get off your bums and Bump!  :P  
Title: The Bumpy Thread
Post by: plymoth45 on September 05, 2005, 09:16:45 PM
Yesh, lets bump! The bump is dying ffs!
Title: The Bumpy Thread
Post by: zigzagjoe on September 05, 2005, 09:28:38 PM
meh bump
Title: The Bumpy Thread
Post by: plymoth45 on September 05, 2005, 10:27:30 PM
it will live on, even if I have to double bump!
Title: The Bumpy Thread
Post by: Hooman on September 06, 2005, 12:13:20 AM
Bump! I finally selected an avatar. Only took how many years?
 
Title: The Bumpy Thread
Post by: instigator on September 06, 2005, 12:20:00 PM
lol @ hooman... yeah i have one too now. thanks for reminding me :P. aww poor penguin got bumped on the head.
Title: The Bumpy Thread
Post by: CK9 on September 06, 2005, 01:50:00 PM
bump to the ead!
Title: The Bumpy Thread
Post by: instigator on September 06, 2005, 02:33:07 PM
Quote
lol @ hooman... yeah i have one too now. thanks for reminding me :P. aww poor penguin got bumped on the head.
my avater was to big  :(  -sigh- he made me bump it
Title: The Bumpy Thread
Post by: CK9 on September 06, 2005, 02:37:36 PM
bump
Title: The Bumpy Thread
Post by: plymoth45 on September 06, 2005, 03:40:53 PM
Quote
Quote
lol @ hooman... yeah i have one too now. thanks for reminding me :P. aww poor penguin got bumped on the head.
my avater was to big  :(  -sigh- he made me bump it
It was the same with my bumping flashy siggy
Title: The Bumpy Thread
Post by: CK9 on September 06, 2005, 03:56:57 PM
bump, try inverting your sip pics, it'sa kinda neet
Title: The Bumpy Thread
Post by: plymoth45 on September 06, 2005, 04:08:52 PM
I know it is, bump, I did it and it was one of the transitions to my flashy siggy before Levy removed it
Title: The Bumpy Thread
Post by: CK9 on September 06, 2005, 04:19:44 PM
too bad there aren't u animated jpegs, lol

now I did :P
Title: The Bumpy Thread
Post by: plymoth45 on September 06, 2005, 04:52:49 PM
It'd be nice it there were, AND YOU DIDN"T BUMP! ROTFL!
Title: The Bumpy Thread
Post by: zigzagjoe on September 06, 2005, 06:05:03 PM
think of the bumping dialup users ! lol
Title: The Bumpy Thread
Post by: Leviathan on September 06, 2005, 06:23:00 PM
bump
Title: The Bumpy Thread
Post by: Stormy on September 06, 2005, 06:46:26 PM
BBBBB
UUUU
MMMM
PPPPP
Title: The Bumpy Thread
Post by: plymoth45 on September 06, 2005, 07:43:13 PM
Quote
think of the bumping dialup users ! lol
Lets not get bumping started on that agani please
Title: The Bumpy Thread
Post by: Stormy on September 06, 2005, 07:51:57 PM
:bump: goes the weasel
Title: The Bumpy Thread
Post by: plymoth45 on September 06, 2005, 08:33:01 PM
bump
Title: The Bumpy Thread
Post by: CK9 on September 06, 2005, 11:21:55 PM
bump

B
Title: The Bumpy Thread
Post by: plymoth45 on September 07, 2005, 06:23:50 PM
bump

U
Title: The Bumpy Thread
Post by: instigator on September 07, 2005, 06:25:29 PM
lol i know where ur bump is going plymoth45
 
Title: The Bumpy Thread
Post by: plymoth45 on September 07, 2005, 09:04:16 PM
Where is my bump going?
M
Title: The Bumpy Thread
Post by: CK9 on September 07, 2005, 11:48:28 PM
it was only a 2 person bump this time :(

P
[/font][/u][/i][/b]
Title: The Bumpy Thread
Post by: plymoth45 on September 08, 2005, 09:22:55 PM
bump sad  :'(  
Title: The Bumpy Thread
Post by: CK9 on September 08, 2005, 11:49:48 PM
bumping again later
Title: The Bumpy Thread
Post by: plymoth45 on September 09, 2005, 10:35:43 PM
and I'm bumping mad I'm not gonn ahave net for 3 months
Title: The Bumpy Thread
Post by: CK9 on September 10, 2005, 03:46:27 PM
bump
Title: The Bumpy Thread
Post by: thablkpanda on September 18, 2005, 06:33:05 PM
I'ma get multi-cultural up in here..

impacto  :D

(That's bump, in spanish.. i'm tha MAN)

Panda
Title: The Bumpy Thread
Post by: instigator on September 18, 2005, 06:34:34 PM
to many sigs on this page...

wont be in for awhile ppl :(

bump
 
Title: The Bumpy Thread
Post by: Eddy-B on September 19, 2005, 04:35:30 AM
is this bump-y thread stil alive ?
Title: The Bumpy Thread
Post by: CK9 on September 19, 2005, 10:20:32 AM
i bump more
Title: The Bumpy Thread
Post by: Leviathan on September 19, 2005, 10:23:34 AM
how about trying to keep the forum active by posting new topic etc?

intead of just bumping
Title: The Bumpy Thread
Post by: Sl0vi on September 19, 2005, 10:48:59 AM
why? Bumping is so much fun :D
Title: The Bumpy Thread
Post by: BlackBox on September 19, 2005, 11:56:28 AM
Bumping is just stupid. lol

Lets spend time in real threads.
Title: The Bumpy Thread
Post by: CK9 on September 19, 2005, 03:01:04 PM
bump u
Title: The Bumpy Thread
Post by: thablkpanda on September 20, 2005, 05:47:36 PM
You can all kiss my

Bump.

There's no reason to make new threads, every possible topic's been covered. Ok not really, but bumping's fun.

Bump.
Panda.
Title: The Bumpy Thread
Post by: CK9 on September 20, 2005, 07:53:22 PM
*bumps panda into a crevass*

oops
Title: The Bumpy Thread
Post by: thablkpanda on September 20, 2005, 08:19:05 PM
*Bumps CK9 into a dictionary*

Crevasse :D


Bumpage
Panda
Title: The Bumpy Thread
Post by: Duo on September 20, 2005, 10:57:29 PM
While I'm here might as well bump someone *bumps CK9*
Title: The Bumpy Thread
Post by: CK9 on September 24, 2005, 04:34:36 PM
*pulls out a giant hammer and bumps people on the head*


MUAHAHAHAHAHA!!!!!!
Title: The Bumpy Thread
Post by: Saibot on September 25, 2005, 07:34:41 AM
[DoHtml]


<form name= "bumpContainer">
Enter a number from 1 to 999:
<input accept="text/plain" maxlength=3 name="t" style="background-color:#000000; color:#00ff00" size=1 value=### onfocus="value=''" id="t" type="text">
          and click on:
         <button onclick="javascript: var t=document.bumpContainer.t.value; while(t > 0){ alert('bump'); t--; }">
                     bump
         </button>
</form>






<form name="now" accept="text/html">
                     
                     

                      <input readonly=readonly type="text" name="prompt1" onmousemove="javascript: document.now.prompt1.value = ''; var x;  for(x = 0; x <= 9; x++){ document.now.prompt1.value += Math.round(x*Math.random()) + ' ';}" size=13>
</form>



[/DoHtml]
Title: The Bumpy Thread
Post by: Mez on September 25, 2005, 11:55:25 AM
bumpin cool!
 
Title: The Bumpy Thread
Post by: CK9 on September 28, 2005, 10:44:19 AM
what does the number bump?
Title: The Bumpy Thread
Post by: Saibot on September 28, 2005, 01:15:32 PM
Quote
what does the number bump?
What it does? If you know that, it want be fun, hehe.

But, it didn't work, so I can tell you anyway: the number you enter is how many times an alertbox with 'bump' shows up. Really funny if you don't know any type 999, hehe.

It work't in the previwe, but after I post it, it seems to got broken. This is how the code looks like:
Code: [Select]
<form name= "bumpContainer">
Enter a <u>number</u> from 1 to 999:
<input accept="text/plain" maxlength=3 name="t" style="background-color:#000000; color:#00ff00" size=1 value=### onfocus="value=''" id="t" type="text">
    and click on:
   <button onclick="javascript: var t=document.bumpContainer.t.value; while(t > 0){ alert('bump'); t--; }">
       bump
   </button>

Rember that this site don't allow <srcipt></srcipt>. So you must write the whole script on one (1) line within some action. Why does the browser take you one site back on bump?
Title: The Bumpy Thread
Post by: CK9 on September 28, 2005, 07:24:51 PM
it worked for me, I just didn't know what the bumping number it came up with was
Title: The Bumpy Thread
Post by: Stormy on October 03, 2005, 05:27:39 PM
BUMPPITY BUMPY BUMP! So, seems like the forum games section has been quiet lately :P

FIRST POST IN A WHILE!
Title: The Bumpy Thread
Post by: spirit1flyer on October 04, 2005, 07:46:57 AM
bump
Title: The Bumpy Thread
Post by: BlackBox on October 04, 2005, 12:19:27 PM
bump
b-u-m-p
b--u--m--p
b---u---m---p
Title: The Bumpy Thread
Post by: CK9 on October 04, 2005, 01:05:52 PM
||\\..||...||.||\\....//||.||\\
||.||.||...||.||..\\//..||.||.||
||//..||...||.||.........||.||//
||\\..||...||.||.........||.||
||.||.||...||.||.........||.||
||//...\\_//.||.........||.||

did my bump work?
Title: The Bumpy Thread
Post by: Mez on October 04, 2005, 03:00:43 PM
\\........//....||..........||...||\\
.\\......//.....||..........||...||..\\
..\\....//......||..........||...||...||
...\\..//.......||..........||...||..//
....\\//........||..........||...||//
.....||..........||.........||....||
.....||..........||.........||....||
.....||...........\\.......//.....||
.....||.............\\__//......||    it sure bumping did,

(could be bothered to do the whole sentance)
Title: The Bumpy Thread
Post by: Stormy on October 04, 2005, 03:24:17 PM
BBBBBB
UUUUUU
MMMMMM
PPPPPP  :rolleyes:  
Title: The Bumpy Thread
Post by: CK9 on October 04, 2005, 05:21:25 PM
I like my big bump
Title: The Bumpy Thread
Post by: leeor_net on October 04, 2005, 06:16:47 PM
Um...

BEEP!!!  :heh:  
Title: The Bumpy Thread
Post by: Stormy on October 04, 2005, 06:17:38 PM
bun bun BUMP!!!!
Title: The Bumpy Thread
Post by: leeor_net on October 04, 2005, 06:17:46 PM
Welp, now we're all spamming the bumpy thread... :D
Title: The Bumpy Thread
Post by: leeor_net on October 04, 2005, 06:18:28 PM
Boop! Beep! Blap! Bloomp! Blip!
Title: The Bumpy Thread
Post by: Stormy on October 04, 2005, 06:19:56 PM
um... you broke a rule!!! lol no double bumping in a row! xD
Title: The Bumpy Thread
Post by: leeor_net on October 04, 2005, 06:56:47 PM
Actually, I said that we were all spamming. Then I made a sound which is not the one everyone else is making. So technically I didn't break the rule.

However, I can see how I made the mistake anyways so it won't happen again.

Bleep.
Title: The Bumpy Thread
Post by: Saibot on October 05, 2005, 02:54:29 AM
[dohtml]
<bgsound src="http://209.197.106.133/19580222/dance/eiffel65/Dub_In_Life.mid" loop=9>
[/dohtml]
Everyone Is looking for the bump in this life Everybody just keep on asking why, why, why? What is bump in this life? Everyone Is looking for the bump in this life, Everybody just keep on asking why, why, why? What is bump bump in this life Everyone Is looking for the bump in this life Everybody just keep on asking why, why, why? What is bump in this life? Everyone Is looking for the bump in this life Everybody just keep on asking why, why, why? What is bump in this life? Everyone Is looking for the bump in this life Everybody just keep on asking why, why, why? What is dub, dub in this life Everyone Is looking for the bump in this life Everybody just keep on asking why, why, why? What is bump, bump in this life Everyone Is looking for the dub in this life Everybody just keep on asking why, why, why? What is bump in this life? Everyone Is looking for the bump in this life Everybody just keep on asking why, why, why? What is bump, bump in this life.
 
Title: The Bumpy Thread
Post by: CK9 on October 05, 2005, 07:25:45 PM
leeor, don't make me get a bumping mallet!
Title: The Bumpy Thread
Post by: Saibot on October 07, 2005, 06:46:42 PM
[DoHtml]
<font color=#222222> . . . . . . .</font>
<font size=1>bump</font>
<font size=2>bump</font>
<font size=3>bump</font>
<font size=4>bump</font>
<font size=5>bump</font>
<font size=6>bump</font>
<font size=7>bump</font>
 <font size=6>bump</font>
<font size=5>bump</font>
<font size=4>bump</font>
<font size=3>bump</font>
<font size=2>bump</font>
<font size=1>bump</font>




<font size=7>bump</font>
<font size=6>bump</font>
<font size=5>bump</font>
<font size=4>bump</font>
<font size=3>bump</font>
<font size=2>bump</font>
<font size=1>bump</font>
 <font size=2>bump</font>
<font size=3>bump</font>
<font size=4>bump</font>
<font size=5>bump</font>
<font size=6>bump</font>
<font size=7>bump</font>
[/DoHtml]
Title: The Bumpy Thread
Post by: CK9 on October 08, 2005, 12:33:53 PM
someone's havoing some bumping fun
Title: The Bumpy Thread
Post by: Stormy on October 08, 2005, 01:15:25 PM
WHO LIKES THE BUMP!!!!  :lol:
WHO LIKES THE BUMP!!!! :lol:
I DO, YOU DO, WE DO, EVERYONE DOES!!!! :lol:

Hmm my little rhyme sounds messed up...  :D  :heh:  :whistle:  
Title: The Bumpy Thread
Post by: thablkpanda on October 08, 2005, 02:01:43 PM
SuperBump.

Because I can.

Christopher M.
Merchant Enterprises
Title: The Bumpy Thread
Post by: CK9 on October 08, 2005, 03:05:52 PM
bump
Title: The Bumpy Thread
Post by: Saibot on October 11, 2005, 11:02:50 AM
[DoHtml]
<span style="color: #2a1010">bump </span>
<span style="color: #2a2a10">bump </span>
<span style="color: #2a2a2a">bump </span>
<span style="color: #442a2a">bump </span>
<span style="color: #44442a">bump </span>
<span style="color: #444444">bump </span>
<span style="color: #5e4444">bump </span>
<span style="color: #5e5e44">bump </span>
<span style="color: #5e5e5e">bump </span>
<span style="color: #785e5e">bump </span>
<span style="color: #78785e">bump </span>
<span style="color: #787878">bump </span>
<span style="color: #927878">bump </span>
<span style="color: #929278">bump </span>
<span style="color: #929292">bump </span>
<span style="color: #ac9292">bump </span>
<span style="color: #acac92">bump </span>
<span style="color: #acacac">bump </span>
<span style="color: #c6acac">bump </span>
<span style="color: #c6c6ac">bump </span>
<span style="color: #c6c6c6">bump </span>
<span style="color: #e0c6c6">bump </span>
<span style="color: #e0e0c6">bump </span>
<span style="color: #e0e0e0">bump </span>
<span style="color: #fae0e0">bump </span>
<span style="color: #fafae0">bump </span>
<span style="color: #fafafa">bump </span>
[/DoHtml]
Title: The Bumpy Thread
Post by: spirit1flyer on October 11, 2005, 11:04:18 AM
here's a bump! there's a bump! everywere a Bump! Bump!
Title: The Bumpy Thread
Post by: Saibot on October 11, 2005, 11:27:24 AM
[DoHtml]
<marquee bgcolor=#000000 scrollamount=200>
<span style="color: #131313">bump </span>
<span style="color: #261313">bump </span>
<span style="color: #262613">bump </span>
<span style="color: #262626">bump </span>
<span style="color: #392626">bump </span>
<span style="color: #393926">bump </span>
<span style="color: #393939">bump </span>
<span style="color: #4c3939">bump </span>
<span style="color: #4c4c39">bump </span>
<span style="color: #4c4c4c">bump </span>
<span style="color: #5f4c4c">bump </span>
<span style="color: #5f5f4c">bump </span>
<span style="color: #5f5f5f">bump </span>
<span style="color: #725f5f">bump </span>
<span style="color: #72725f">bump </span>
<span style="color: #727272">bump </span>
<span style="color: #857272">bump </span>
<span style="color: #858572">bump </span>
<span style="color: #858585">bump </span>
<span style="color: #988585">bump </span>
<span style="color: #989885">bump </span>
<span style="color: #989898">bump </span>
<span style="color: #ab9898">bump </span>
<span style="color: #abab98">bump </span>
<span style="color: #ababab">bump </span>
<span style="color: #beabab">bump </span>
<span style="color: #bebeab">bump </span>
<span style="color: #bebebe">bump </span>
<span style="color: #d1bebe">bump </span>
<span style="color: #d1d1be">bump </span>
<span style="color: #d1d1d1">bump </span>
<span style="color: #e4d1d1">bump </span>
<span style="color: #e4e4d1">bump </span>
<span style="color: #e4e4e4">bump </span>
<span style="color: #f7e4e4">bump </span>
<span style="color: #f7f7e4">bump </span>
<span style="color: #f7f7f7">bump </span>

<span style="color: #e4f7f7">bump </span>
<span style="color: #e4e4f7">bump </span>
<span style="color: #e4e4e4">bump </span>
<span style="color: #d1e4e4">bump </span>
<span style="color: #d1d1e4">bump </span>
<span style="color: #d1d1d1">bump </span>
<span style="color: #bed1d1">bump </span>
<span style="color: #bebed1">bump </span>
<span style="color: #bebebe">bump </span>
<span style="color: #abbebe">bump </span>
<span style="color: #ababbe">bump </span>
<span style="color: #ababab">bump </span>
<span style="color: #98abab">bump </span>
<span style="color: #9898ab">bump </span>
<span style="color: #989898">bump </span>
<span style="color: #859898">bump </span>
<span style="color: #858598">bump </span>
<span style="color: #858585">bump </span>
<span style="color: #728585">bump </span>
<span style="color: #727285">bump </span>
<span style="color: #727272">bump </span>
<span style="color: #5f7272">bump </span>
<span style="color: #5f5f72">bump </span>
<span style="color: #5f5f5f">bump </span>
<span style="color: #4c5f5f">bump </span>
<span style="color: #4c4c5f">bump </span>
<span style="color: #4c4c4c">bump </span>
<span style="color: #394c4c">bump </span>
<span style="color: #39394c">bump </span>
<span style="color: #393939">bump </span>
<span style="color: #263939">bump </span>
<span style="color: #262639">bump </span>
<span style="color: #262626">bump </span>
<span style="color: #132626">bump </span>
<span style="color: #131326">bump </span>
<span style="color: #131313">bump </span>



<span style="color: #131313">bump </span>
<span style="color: #261313">bump </span>
<span style="color: #262613">bump </span>
<span style="color: #262626">bump </span>
<span style="color: #392626">bump </span>
<span style="color: #393926">bump </span>
<span style="color: #393939">bump </span>
<span style="color: #4c3939">bump </span>
<span style="color: #4c4c39">bump </span>
<span style="color: #4c4c4c">bump </span>
<span style="color: #5f4c4c">bump </span>
<span style="color: #5f5f4c">bump </span>
<span style="color: #5f5f5f">bump </span>
<span style="color: #725f5f">bump </span>
<span style="color: #72725f">bump </span>
<span style="color: #727272">bump </span>
<span style="color: #857272">bump </span>
<span style="color: #858572">bump </span>
<span style="color: #858585">bump </span>
<span style="color: #988585">bump </span>
<span style="color: #989885">bump </span>
<span style="color: #989898">bump </span>
<span style="color: #ab9898">bump </span>
<span style="color: #abab98">bump </span>
<span style="color: #ababab">bump </span>
<span style="color: #beabab">bump </span>
<span style="color: #bebeab">bump </span>
<span style="color: #bebebe">bump </span>
<span style="color: #d1bebe">bump </span>
<span style="color: #d1d1be">bump </span>
<span style="color: #d1d1d1">bump </span>
<span style="color: #e4d1d1">bump </span>
<span style="color: #e4e4d1">bump </span>
<span style="color: #e4e4e4">bump </span>
<span style="color: #f7e4e4">bump </span>
<span style="color: #f7f7e4">bump </span>
<span style="color: #f7f7f7">bump </span>

<span style="color: #e4f7f7">bump </span>
<span style="color: #e4e4f7">bump </span>
<span style="color: #e4e4e4">bump </span>
<span style="color: #d1e4e4">bump </span>
<span style="color: #d1d1e4">bump </span>
<span style="color: #d1d1d1">bump </span>
<span style="color: #bed1d1">bump </span>
<span style="color: #bebed1">bump </span>
<span style="color: #bebebe">bump </span>
<span style="color: #abbebe">bump </span>
<span style="color: #ababbe">bump </span>
<span style="color: #ababab">bump </span>
<span style="color: #98abab">bump </span>
<span style="color: #9898ab">bump </span>
<span style="color: #989898">bump </span>
<span style="color: #859898">bump </span>
<span style="color: #858598">bump </span>
<span style="color: #858585">bump </span>
<span style="color: #728585">bump </span>
<span style="color: #727285">bump </span>
<span style="color: #727272">bump </span>
<span style="color: #5f7272">bump </span>
<span style="color: #5f5f72">bump </span>
<span style="color: #5f5f5f">bump </span>
<span style="color: #4c5f5f">bump </span>
<span style="color: #4c4c5f">bump </span>
<span style="color: #4c4c4c">bump </span>
<span style="color: #394c4c">bump </span>
<span style="color: #39394c">bump </span>
<span style="color: #393939">bump </span>
<span style="color: #263939">bump </span>
<span style="color: #262639">bump </span>
<span style="color: #262626">bump </span>
<span style="color: #132626">bump </span>
<span style="color: #131326">bump </span>
<span style="color: #131313">bump </span>
</marquee>
<marquee bgcolor=#000000 scrollamount=107 direction=right>
<span style="color: #131313">bump </span>
<span style="color: #261313">bump </span>
<span style="color: #262613">bump </span>
<span style="color: #262626">bump </span>
<span style="color: #392626">bump </span>
<span style="color: #393926">bump </span>
<span style="color: #393939">bump </span>
<span style="color: #4c3939">bump </span>
<span style="color: #4c4c39">bump </span>
<span style="color: #4c4c4c">bump </span>
<span style="color: #5f4c4c">bump </span>
<span style="color: #5f5f4c">bump </span>
<span style="color: #5f5f5f">bump </span>
<span style="color: #725f5f">bump </span>
<span style="color: #72725f">bump </span>
<span style="color: #727272">bump </span>
<span style="color: #857272">bump </span>
<span style="color: #858572">bump </span>
<span style="color: #858585">bump </span>
<span style="color: #988585">bump </span>
<span style="color: #989885">bump </span>
<span style="color: #989898">bump </span>
<span style="color: #ab9898">bump </span>
<span style="color: #abab98">bump </span>
<span style="color: #ababab">bump </span>
<span style="color: #beabab">bump </span>
<span style="color: #bebeab">bump </span>
<span style="color: #bebebe">bump </span>
<span style="color: #d1bebe">bump </span>
<span style="color: #d1d1be">bump </span>
<span style="color: #d1d1d1">bump </span>
<span style="color: #e4d1d1">bump </span>
<span style="color: #e4e4d1">bump </span>
<span style="color: #e4e4e4">bump </span>
<span style="color: #f7e4e4">bump </span>
<span style="color: #f7f7e4">bump </span>
<span style="color: #f7f7f7">bump </span>

<span style="color: #e4f7f7">bump </span>
<span style="color: #e4e4f7">bump </span>
<span style="color: #e4e4e4">bump </span>
<span style="color: #d1e4e4">bump </span>
<span style="color: #d1d1e4">bump </span>
<span style="color: #d1d1d1">bump </span>
<span style="color: #bed1d1">bump </span>
<span style="color: #bebed1">bump </span>
<span style="color: #bebebe">bump </span>
<span style="color: #abbebe">bump </span>
<span style="color: #ababbe">bump </span>
<span style="color: #ababab">bump </span>
<span style="color: #98abab">bump </span>
<span style="color: #9898ab">bump </span>
<span style="color: #989898">bump </span>
<span style="color: #859898">bump </span>
<span style="color: #858598">bump </span>
<span style="color: #858585">bump </span>
<span style="color: #728585">bump </span>
<span style="color: #727285">bump </span>
<span style="color: #727272">bump </span>
<span style="color: #5f7272">bump </span>
<span style="color: #5f5f72">bump </span>
<span style="color: #5f5f5f">bump </span>
<span style="color: #4c5f5f">bump </span>
<span style="color: #4c4c5f">bump </span>
<span style="color: #4c4c4c">bump </span>
<span style="color: #394c4c">bump </span>
<span style="color: #39394c">bump </span>
<span style="color: #393939">bump </span>
<span style="color: #263939">bump </span>
<span style="color: #262639">bump </span>
<span style="color: #262626">bump </span>
<span style="color: #132626">bump </span>
<span style="color: #131326">bump </span>
<span style="color: #131313">bump </span>



<span style="color: #131313">bump </span>
<span style="color: #261313">bump </span>
<span style="color: #262613">bump </span>
<span style="color: #262626">bump </span>
<span style="color: #392626">bump </span>
<span style="color: #393926">bump </span>
<span style="color: #393939">bump </span>
<span style="color: #4c3939">bump </span>
<span style="color: #4c4c39">bump </span>
<span style="color: #4c4c4c">bump </span>
<span style="color: #5f4c4c">bump </span>
<span style="color: #5f5f4c">bump </span>
<span style="color: #5f5f5f">bump </span>
<span style="color: #725f5f">bump </span>
<span style="color: #72725f">bump </span>
<span style="color: #727272">bump </span>
<span style="color: #857272">bump </span>
<span style="color: #858572">bump </span>
<span style="color: #858585">bump </span>
<span style="color: #988585">bump </span>
<span style="color: #989885">bump </span>
<span style="color: #989898">bump </span>
<span style="color: #ab9898">bump </span>
<span style="color: #abab98">bump </span>
<span style="color: #ababab">bump </span>
<span style="color: #beabab">bump </span>
<span style="color: #bebeab">bump </span>
<span style="color: #bebebe">bump </span>
<span style="color: #d1bebe">bump </span>
<span style="color: #d1d1be">bump </span>
<span style="color: #d1d1d1">bump </span>
<span style="color: #e4d1d1">bump </span>
<span style="color: #e4e4d1">bump </span>
<span style="color: #e4e4e4">bump </span>
<span style="color: #f7e4e4">bump </span>
<span style="color: #f7f7e4">bump </span>
<span style="color: #f7f7f7">bump </span>

<span style="color: #e4f7f7">bump </span>
<span style="color: #e4e4f7">bump </span>
<span style="color: #e4e4e4">bump </span>
<span style="color: #d1e4e4">bump </span>
<span style="color: #d1d1e4">bump </span>
<span style="color: #d1d1d1">bump </span>
<span style="color: #bed1d1">bump </span>
<span style="color: #bebed1">bump </span>
<span style="color: #bebebe">bump </span>
<span style="color: #abbebe">bump </span>
<span style="color: #ababbe">bump </span>
<span style="color: #ababab">bump </span>
<span style="color: #98abab">bump </span>
<span style="color: #9898ab">bump </span>
<span style="color: #989898">bump </span>
<span style="color: #859898">bump </span>
<span style="color: #858598">bump </span>
<span style="color: #858585">bump </span>
<span style="color: #728585">bump </span>
<span style="color: #727285">bump </span>
<span style="color: #727272">bump </span>
<span style="color: #5f7272">bump </span>
<span style="color: #5f5f72">bump </span>
<span style="color: #5f5f5f">bump </span>
<span style="color: #4c5f5f">bump </span>
<span style="color: #4c4c5f">bump </span>
<span style="color: #4c4c4c">bump </span>
<span style="color: #394c4c">bump </span>
<span style="color: #39394c">bump </span>
<span style="color: #393939">bump </span>
<span style="color: #263939">bump </span>
<span style="color: #262639">bump </span>
<span style="color: #262626">bump </span>
<span style="color: #132626">bump </span>
<span style="color: #131326">bump </span>
<span style="color: #131313">bump </span>
</marquee>
[/DoHtml]
Title: The Bumpy Thread
Post by: CK9 on October 11, 2005, 01:31:47 PM
make an infinatesimal bump!
Title: The Bumpy Thread
Post by: leeor_net on October 11, 2005, 04:04:18 PM
POKE!
Title: The Bumpy Thread
Post by: instigator on October 12, 2005, 10:12:11 AM
LOL @ poke! ...

so who is bumping again!?
Title: The Bumpy Thread
Post by: CK9 on October 12, 2005, 10:12:53 AM
That's it, time to edit posts to add in bumps!
Title: The Bumpy Thread
Post by: Stormy on October 12, 2005, 07:04:55 PM
Bump

I envy your very very cool bumps saibot!
Teach me please!!! :D:D:D
Title: The Bumpy Thread
Post by: Freeza-CII on October 12, 2005, 07:21:28 PM
BUMP damn it
Title: The Bumpy Thread
Post by: Betaray on October 12, 2005, 07:27:35 PM
jerkel bump
Title: The Bumpy Thread
Post by: Stormy on October 12, 2005, 07:36:33 PM
BUM BUMP!@
Title: The Bumpy Thread
Post by: Freeza-CII on October 12, 2005, 07:57:00 PM
BUMP A DE BUMP BUMP
Title: The Bumpy Thread
Post by: CK9 on October 12, 2005, 08:22:40 PM
bump
Title: The Bumpy Thread
Post by: Freeza-CII on October 13, 2005, 07:11:59 PM
(http://www.freeza.outpostuniverse.net/images/bump1.gif)

Get up Get up Bump Bump now get down bumpy till you just cant bumpy no more
Title: The Bumpy Thread
Post by: CK9 on October 13, 2005, 07:15:20 PM
Time to lyric bump!

"You see me and you laugh out loud
You taunt me from safe inside your crowd
My looks, they must threaten you
To make you act the way you do

Red, I'm seeing red

You see me and you think I'm a jerk
First impressions without a word
You can't believe your eyes at first
But know you know you've seen the worst

Red, I'm seeing red"
 - Minor Threat, Seeing Red
Title: The Bumpy Thread
Post by: Stormy on October 13, 2005, 08:58:12 PM
BUMP
Title: The Bumpy Thread
Post by: CK9 on October 14, 2005, 08:11:55 AM
am I the only lyric bumper?
Title: The Bumpy Thread
Post by: Sl0vi on October 14, 2005, 08:51:21 PM
bump?
Title: The Bumpy Thread
Post by: Betaray on October 14, 2005, 09:49:03 PM
The sky is blue and all the leaves are green.
The sun's as warm as a baked potato.
I think I know precisely what I mean,
When I say it's a shpadoinkle day.

And as I ride with my girl,
She's my best friend in the whole world!
We'll move along, set our goals high
With eyes full of hope as we aim for the...

Sky is blue and all the leaves are green.
My heart's as full as a baked potato.
I think I know precisely what I mean,
When I say it's a shpadoinkle day!
When I say it's a happy-go-moinkaly lucky shpadoinklely...dayyyyyy.

bump!!!
Title: The Bumpy Thread
Post by: Saibot on October 15, 2005, 01:27:57 PM
I wish that was true, in this very moment here in Sweden.
It's so bumping cold, and the leaves are in all colors.
Title: The Bumpy Thread
Post by: CK9 on October 16, 2005, 01:47:55 AM
BUMP~
Title: The Bumpy Thread
Post by: Mez on October 16, 2005, 11:19:30 AM
bump
Title: The Bumpy Thread
Post by: Stormy on October 16, 2005, 09:55:08 PM
bumppy bump... This is gettting old fast. :P
Title: The Bumpy Thread
Post by: CK9 on October 16, 2005, 11:37:09 PM
no it bumping isn't!!!


okay, you're right...it is...
Title: The Bumpy Thread
Post by: Saibot on October 17, 2005, 07:09:02 AM
¡w00t bump t00w!
Title: The Bumpy Thread
Post by: CK9 on October 17, 2005, 08:14:29 AM
bump
Title: The Bumpy Thread
Post by: Mez on October 19, 2005, 03:06:17 PM
booooummmmmmp
Title: The Bumpy Thread
Post by: CK9 on October 19, 2005, 03:07:42 PM
*bups mezza for his comment in the person above me thread*


bump you fool - edit by mezza
Title: The Bumpy Thread
Post by: Mez on October 19, 2005, 03:22:04 PM
bumps ck9 and edits his incorect bump post, bumpin idiot
Title: The Bumpy Thread
Post by: thablkpanda on October 19, 2005, 06:20:21 PM
Anybody wanna touch my bamboo stick? Lol, damn you can tell i'm tired.

Panda- Bumpin to the bed.. and bumpin IN the bed..  
Title: The Bumpy Thread
Post by: CK9 on October 19, 2005, 07:48:57 PM
*bumps mezza on the head*
Title: The Bumpy Thread
Post by: Stormy on October 19, 2005, 08:39:17 PM
bumps you 'till you're dead :P RHYMING TIME!!!!! w00t t00w o.0 0.o >.> <.< ^.^ o.o
Title: The Bumpy Thread
Post by: Freeza-CII on October 19, 2005, 10:03:05 PM
Bump thump dump glump pump lump mump  
Title: The Bumpy Thread
Post by: CK9 on October 20, 2005, 01:18:46 PM
Did you bump it in a box?
Did you bump it with a fox?
On some rocks?
In your socks?
Bumping all around the clocks?
Title: The Bumpy Thread
Post by: Mez on October 20, 2005, 01:37:02 PM
bump
Title: The Bumpy Thread
Post by: Hooman on October 20, 2005, 06:01:38 PM
Bump.

Ha! I bet you didn't expect that from me.
 
Title: The Bumpy Thread
Post by: CK9 on October 20, 2005, 06:05:54 PM
that was bumping predictable
Title: The Bumpy Thread
Post by: leeor_net on October 21, 2005, 08:54:25 AM
bleep


(http://www.freeza.outpostuniverse.net/images/bump1.gif)
Title: The Bumpy Thread
Post by: CK9 on October 21, 2005, 09:37:34 AM
who want's to try to do a beatnick bump?
Title: The Bumpy Thread
Post by: Mez on October 21, 2005, 02:53:29 PM
budmpin bump
Title: The Bumpy Thread
Post by: CK9 on October 21, 2005, 03:29:08 PM
monamana

bump
Title: The Bumpy Thread
Post by: Stormy on November 06, 2005, 08:12:54 PM
bumpo bump
Title: The Bumpy Thread
Post by: CK9 on November 06, 2005, 10:12:42 PM
bump
Title: The Bumpy Thread
Post by: leeor_net on November 07, 2005, 07:41:43 PM
bump
Title: The Bumpy Thread
Post by: CK9 on November 07, 2005, 08:07:18 PM
bump
Title: The Bumpy Thread
Post by: Stormy on November 07, 2005, 08:34:29 PM
bump
Title: The Bumpy Thread
Post by: CK9 on November 07, 2005, 10:35:18 PM
bump
Title: The Bumpy Thread
Post by: Stormy on November 08, 2005, 07:53:15 PM
bump
Title: The Bumpy Thread
Post by: leeor_net on November 09, 2005, 05:59:35 PM
bump
Title: The Bumpy Thread
Post by: CK9 on November 10, 2005, 10:30:59 AM
bump
Title: The Bumpy Thread
Post by: Betaray on November 10, 2005, 01:14:29 PM
01100010 01110101 01101101 01110000
Title: The Bumpy Thread
Post by: leeor_net on November 10, 2005, 06:28:49 PM
bump
Title: The Bumpy Thread
Post by: Stormy on November 10, 2005, 07:05:41 PM
bump
Title: The Bumpy Thread
Post by: Betaray on November 10, 2005, 07:16:50 PM
πρόσκρουση
Title: The Bumpy Thread
Post by: Stormy on November 10, 2005, 08:02:36 PM
BAD BOY!!! You must BUMP!!!

BUMP , the future drink of champions. No more Tang... It's got monkey hair in it!

:P:P:P
Title: The Bumpy Thread
Post by: Betaray on November 10, 2005, 08:04:00 PM
thats bump in greek lol
Title: The Bumpy Thread
Post by: Stormy on November 10, 2005, 10:23:08 PM
hahah.... hmmm is that true? Soemoen else tell if it is so! Or so Bump it!
Title: The Bumpy Thread
Post by: CK9 on November 10, 2005, 10:33:04 PM
that "greek bump" translates to impaction or concusion...very loosely synonomous I think
Title: The Bumpy Thread
Post by: Betaray on November 11, 2005, 08:44:04 AM
I used an online translater I found with google to make that bump lol
Title: The Bumpy Thread
Post by: CK9 on November 11, 2005, 12:31:13 PM
wi\ell, ignore my bumping shout then, lol
Title: The Bumpy Thread
Post by: Betaray on November 11, 2005, 01:24:32 PM
http://www.google.com/search?q=bump&source...:en-US:official (http://www.google.com/search?q=bump&sourceid=mozilla-search&start=0&start=0&ie=utf-8&oe=utf-8&client=firefox-a&rls=org.mozilla:en-US:official)
Title: The Bumpy Thread
Post by: CK9 on November 11, 2005, 04:01:29 PM
http://www.altavista.com/web/results?itag=...ump&kgs=1&kls=0 (http://www.altavista.com/web/results?itag=ody&q=bump&kgs=1&kls=0)

http://www.discovergames.com/Bump.html (http://www.discovergames.com/Bump.html)
Title: The Bumpy Thread
Post by: Mez on November 14, 2005, 12:59:07 PM
bump
Title: The Bumpy Thread
Post by: Betaray on November 14, 2005, 01:27:18 PM
the bumpanater!!
Title: The Bumpy Thread
Post by: BlackBox on November 14, 2005, 01:32:11 PM
bump it etc.
bump bump

[doHTML]<button onClick="alert('Bump to you too');"><h1><font color="red">BUMP</font></h1></button>[/doHTML]
Title: The Bumpy Thread
Post by: CK9 on November 14, 2005, 10:24:38 PM
bump
Title: The Bumpy Thread
Post by: Stormy on November 17, 2005, 09:48:08 PM
bump
Title: The Bumpy Thread
Post by: CK9 on November 18, 2005, 09:48:54 AM
bump
Title: The Bumpy Thread
Post by: Sl0vi on November 24, 2005, 11:32:04 AM
bump?
Title: The Bumpy Thread
Post by: CK9 on November 24, 2005, 06:40:10 PM
bump
Title: The Bumpy Thread
Post by: zhukant on November 24, 2005, 07:39:50 PM
Heh... a month ago some weird people installed these reeeally stretched out speed bumps on my street, and on the road before each one it says speed hump, but since they write it bottom to top on roads, it looks like hump speed. So are you supposed to be going at the speed you hump, or what? :P j/k
Title: The Bumpy Thread
Post by: Stormy on November 24, 2005, 11:49:10 PM
uh huh.... haha....

bump

 
Title: The Bumpy Thread
Post by: Betaray on November 24, 2005, 11:51:39 PM
sirbumpsalot
Title: The Bumpy Thread
Post by: Stormy on November 25, 2005, 12:20:00 AM
bump
Title: The Bumpy Thread
Post by: Betaray on November 25, 2005, 12:52:42 AM
bumpaboo?
Title: The Bumpy Thread
Post by: CK9 on November 25, 2005, 01:02:24 AM
I have the bumping taste of blood in my mouth...and it's my blood...and it's kinda making me feel ill...
Title: The Bumpy Thread
Post by: siqueule on November 25, 2005, 10:29:59 AM
bumping in a post old of 16 hours...  B)  
Title: The Bumpy Thread
Post by: Stormy on November 25, 2005, 11:00:01 AM
bump
Title: The Bumpy Thread
Post by: CK9 on November 25, 2005, 02:16:21 PM
bump
Title: The Bumpy Thread
Post by: Stormy on November 26, 2005, 12:18:05 AM
bump
Title: The Bumpy Thread
Post by: CK9 on November 26, 2005, 12:20:50 AM
bumping error message:

mySQL query error: UPDATE inv_members SET refer_val=refer_val,points=points+ WHERE id='40' LIMIT 1

mySQL error: You have an error in your SQL syntax.  Check the manual that corresponds to your MySQL server version for the right syntax to use near 'WHERE id='40' LIMIT 1' at line 1
mySQL error code:
Date: Saturday 26th of November 2005 01:17:57 AM

why do I get that error here every time I clean out my internet cache?
Title: The Bumpy Thread
Post by: Stormy on November 26, 2005, 04:53:29 PM
bump
Title: The Bumpy Thread
Post by: CK9 on November 26, 2005, 09:19:37 PM
bump
Title: The Bumpy Thread
Post by: Betaray on November 26, 2005, 09:38:55 PM
bump
Title: The Bumpy Thread
Post by: CK9 on November 27, 2005, 02:27:19 AM
catch the bump!
Title: The Bumpy Thread
Post by: Betaray on November 27, 2005, 12:52:34 PM
jerbumparo!!!
Title: The Bumpy Thread
Post by: CK9 on November 27, 2005, 07:50:00 PM
BUMPZAI!!!!!!!!!
Title: The Bumpy Thread
Post by: Betaray on November 27, 2005, 07:58:17 PM
BUMPZILLA!!!
Title: The Bumpy Thread
Post by: CK9 on November 28, 2005, 12:25:30 AM
bumpasaurous rex!
Title: The Bumpy Thread
Post by: Freeza-CII on November 28, 2005, 11:51:50 AM
ill have some of that bump garnished with the bump  and a side of bump please

Dont make me go upside your bump

Greetings bumps and bumpets lol

HOT BUMP ON BUMP ACTION CLICK HERE

Bump me once shame on you Bump me twice shame on me

A bump in the hand is worth two in the bush

THE BUMP LYNX   :D

Outpost 3: BUMP

"BOB" is now BUMP

BAA Bump Aholics Anonymus

Free range Bump

Bump now and Bump one free

 
Title: The Bumpy Thread
Post by: Mez on November 28, 2005, 02:16:31 PM
Nice recipe for Op bump, can i have a slice of that bumpberry pie?
Title: The Bumpy Thread
Post by: CK9 on November 28, 2005, 02:51:53 PM
amscray you bumperheads!
Title: The Bumpy Thread
Post by: Stormy on November 28, 2005, 03:09:20 PM
bump
Title: The Bumpy Thread
Post by: CK9 on November 28, 2005, 03:34:34 PM
bump
Title: The Bumpy Thread
Post by: Betaray on November 28, 2005, 03:58:17 PM
welcome to bump, here on bump all persions places and things are referred to as bump

Bump, these bumps want to change your bump. They don't want bump or any of these bumps to live here because it's bad for their bump. They use bump to try and force bumps to believe they're bump. If you let them stay here, they will build bumps and bumps. They will take all your bumps and replace them with bump. These bump have no good bump to live on bump, so they must come here to bump. Please, let these bumps stay where they can grow and prosper without any bumps, bumps, eh or bumps.
Title: The Bumpy Thread
Post by: CK9 on November 28, 2005, 04:03:16 PM
through our bumping we are one community
Title: The Bumpy Thread
Post by: Betaray on November 28, 2005, 04:10:01 PM
we accept bump, we accept bump, one of bump, one of bump
Title: The Bumpy Thread
Post by: CK9 on November 28, 2005, 04:12:34 PM
but I'm bumping just like everyone, I could be anyone
Title: The Bumpy Thread
Post by: Betaray on November 28, 2005, 04:17:10 PM
I could be bump
Title: The Bumpy Thread
Post by: CK9 on November 28, 2005, 04:18:44 PM
bump
Title: The Bumpy Thread
Post by: Betaray on November 28, 2005, 05:24:10 PM
bump?
Title: The Bumpy Thread
Post by: CK9 on November 28, 2005, 08:28:29 PM
bump
Title: The Bumpy Thread
Post by: Betaray on November 28, 2005, 08:34:45 PM
bump!!!
Title: The Bumpy Thread
Post by: CK9 on November 28, 2005, 08:40:27 PM
I'm getting bumping pissed!  I need the indeo 5.2 (indeo XP) otherwise the vid files won't play, and some textures will be fed up!
Title: The Bumpy Thread
Post by: Betaray on November 28, 2005, 08:42:04 PM
no idea what bumping program that is
Title: The Bumpy Thread
Post by: CK9 on November 28, 2005, 08:46:25 PM
you're no bumping help!
Title: The Bumpy Thread
Post by: Betaray on November 28, 2005, 08:46:51 PM
no im bumping not!!
Title: The Bumpy Thread
Post by: CK9 on November 28, 2005, 08:47:48 PM
bump
Title: The Bumpy Thread
Post by: Betaray on November 28, 2005, 08:59:07 PM
chabump
Title: The Bumpy Thread
Post by: CK9 on November 29, 2005, 12:08:13 AM
Days of the Pheonix bump!

I remember when I was told a story of
crushed velvet, candle wax, and dried up flowers.
The figure on the bed,
all dressed up in roses, calling...
beckoning to sleep...offering a dream.

The words were as mystical as purring animals
The circle of rage...the ghosts on the stage appeared.
The time was so tangible I'll never let it go.
Ghost stories handed down, reached secret tunnels below.

No one could see me.

I fell into yesterday.
Our dreams seemed not far away.
I want to, I want to, I want to stay
I fell into fantasy.

The words were as mystical as purring animals.
The circle of rage...the ghosts on the stage appeared.
The time was so tangible, I'll never let it go.
Ghost stories handed down, reached secret tunnels of below.

No one could see me.

I fell into yesterday.
Our dreams seemed not far away.
I want to, I want to, I want to stay.
I fell into fantasy.


The girl on the wall always waited for me, and she was always smiling.
The teenage death boys, the teenage death girls...
and everyone was dancing.
Nothing could touch us then,
no one could change us then, and everyone was dancing.
Nothing could hurt us then, no one could see us then,
and everyone was dancing.
Everyone was dancing.

No one could see me.

I fell into yesterday.
Our dreams seemed not far away.
I want to, I want to, I want to stay
I fell into fantasy.

Our dreams seemed not far away.
Our dreams seemed not far away.
Our dreams seemed not far away.

I fell into fantasy.
Title: The Bumpy Thread
Post by: Freeza-CII on November 29, 2005, 02:14:07 PM
*hands CK9 a sack of bump*
Title: The Bumpy Thread
Post by: CK9 on November 29, 2005, 03:17:30 PM
Anyone want to know what that bumping song is about?
Title: The Bumpy Thread
Post by: Betaray on December 02, 2005, 08:22:20 PM
bumping?
Title: The Bumpy Thread
Post by: CK9 on December 03, 2005, 02:41:00 AM
was that a yes bump?
Title: The Bumpy Thread
Post by: Stormy on December 05, 2005, 06:49:31 PM
Yes, but New York bumps courtiously (from some movie from the signing of the US Declaration of Independence, where NY abstains courtiously from all votes..)
Title: The Bumpy Thread
Post by: CK9 on December 05, 2005, 07:42:23 PM
bump?
Title: The Bumpy Thread
Post by: Stormy on December 05, 2005, 09:58:53 PM
Yes, Bump:

1. (u for ultimate) The word used in CK9's Bumpy Thread.
2. (n) The thing in the road.
3. (Insert definition here)
Title: The Bumpy Thread
Post by: Betaray on December 06, 2005, 08:44:39 AM
ahh bump, now I get it
Title: The Bumpy Thread
Post by: CK9 on December 06, 2005, 12:25:16 PM
could you bump a slice of cake over to me?
Title: The Bumpy Thread
Post by: Betaray on December 06, 2005, 02:00:19 PM
easy as bump
Title: The Bumpy Thread
Post by: CK9 on December 06, 2005, 03:18:38 PM
bump here you rascle!
Title: The Bumpy Thread
Post by: Stormy on December 06, 2005, 03:41:48 PM
Bum BUMP!  
Title: The Bumpy Thread
Post by: Stormy on December 11, 2005, 12:21:27 AM
uh it's past 3 days lol :P

BUMP
Title: The Bumpy Thread
Post by: Betaray on December 11, 2005, 12:30:29 AM
if only I was still a bumping GM
Title: The Bumpy Thread
Post by: CK9 on December 12, 2005, 08:39:43 AM
I accidentally deleted my bump first :(
Title: The Bumpy Thread
Post by: Betaray on December 12, 2005, 01:24:03 PM
whoopsabumpy
Title: The Bumpy Thread
Post by: Freeza-CII on December 12, 2005, 01:57:58 PM
i cant wait for santa bumps to bring me a bump under my bump tree while i sleep on bumpmass eve
Title: The Bumpy Thread
Post by: CK9 on December 12, 2005, 04:06:07 PM
I want a bumping full trap set, but I don't have enough bumping room for one at home :(
Title: The Bumpy Thread
Post by: Sl0vi on December 17, 2005, 12:08:29 AM
bump
Title: The Bumpy Thread
Post by: CK9 on December 17, 2005, 02:15:54 AM
bump
Title: The Bumpy Thread
Post by: Freeza-CII on December 17, 2005, 02:17:44 AM
ZEEKY BOOGY BUMP
Title: The Bumpy Thread
Post by: CK9 on December 17, 2005, 02:25:03 AM
BUMP!
Title: The Bumpy Thread
Post by: Freeza-CII on December 17, 2005, 02:28:17 AM
/me passes CK9 the H-Bump
Title: The Bumpy Thread
Post by: CK9 on December 17, 2005, 01:21:11 PM
/me tries to pass it back, but the bump hits the ground
Title: The Bumpy Thread
Post by: Stormy on December 18, 2005, 06:32:51 PM
bump
Title: The Bumpy Thread
Post by: Sl0vi on December 20, 2005, 10:00:46 AM
bump
Title: The Bumpy Thread
Post by: OP2Patriot on January 02, 2006, 03:10:41 PM
BUMP!

Whatever happened to the original Bumpy Thread that I started?
Title: The Bumpy Thread
Post by: instigator on January 02, 2006, 03:38:07 PM
lol! the bump lived a long time...

BUT THE BUMP WILL NEVER DIE!!!!!

 (thumbsup)  
Title: The Bumpy Thread
Post by: OP2Patriot on January 02, 2006, 03:40:35 PM
We are not talking about a cancer bump, are we?
Title: The Bumpy Thread
Post by: CK9 on January 02, 2006, 06:55:23 PM
nice sig phil

*bumps patriot into the next tube junction*
Title: The Bumpy Thread
Post by: plymoth45 on January 02, 2006, 08:55:46 PM
funny... the bumpy thread hasn't grown much since I last looked at it.
Title: The Bumpy Thread
Post by: OP2Patriot on January 02, 2006, 11:31:10 PM
*bumps CK9 into tomorrow.* Not much of an effort since tomorrow from him is only 90 minutes away.
Title: The Bumpy Thread
Post by: Mez on January 03, 2006, 05:16:06 AM
bumping kinda slowed down since saibot stopped bumping lol.
Title: The Bumpy Thread
Post by: plymoth45 on January 03, 2006, 09:33:09 AM
you mean the bump died for a while? bumper!
Title: The Bumpy Thread
Post by: CK9 on January 03, 2006, 07:28:01 PM
yes, bumping isn't as popular
Title: The Bumpy Thread
Post by: OP2Patriot on January 03, 2006, 07:41:25 PM
Oh well *bumps CK9 into cold river*
Title: The Bumpy Thread
Post by: lordly_dragon on January 03, 2006, 09:20:46 PM
*bump the conservative that are against the progress in the opu community*  
Title: The Bumpy Thread
Post by: CK9 on January 03, 2006, 09:35:08 PM
*bumps phil in front of a hungry lion*

Just stay as still as possible!  They're used to their prey running!
Title: The Bumpy Thread
Post by: plymoth45 on January 03, 2006, 11:02:14 PM
*Bumps himself out of Phill's and Ck's line of fire*

This could be dangerous...
Title: The Bumpy Thread
Post by: CK9 on January 04, 2006, 02:18:25 AM
*bumps on the tractor beam, freezing plym*

stay aa while :P
Title: The Bumpy Thread
Post by: plymoth45 on January 04, 2006, 09:24:21 AM
*Bumps on the repulsive tractor beam to counter*

Nah I don't think I will :P
Title: The Bumpy Thread
Post by: lordly_dragon on January 04, 2006, 10:25:16 AM
*bump scotty from star-trec so he can stop that stupid beam*
Title: The Bumpy Thread
Post by: plymoth45 on January 04, 2006, 10:45:54 AM
what, is everyone bumpin agianst me? lol
Title: The Bumpy Thread
Post by: lordly_dragon on January 04, 2006, 07:15:25 PM
bump away your insignificant answer
Title: The Bumpy Thread
Post by: CK9 on January 04, 2006, 11:46:11 PM
*bumps the fighter jet with an apache helicopter*
Title: The Bumpy Thread
Post by: plymoth45 on January 05, 2006, 09:26:48 AM
*Bumps LD away with a type 9 phaser*
Title: The Bumpy Thread
Post by: Mez on January 05, 2006, 12:47:21 PM
Doesn;t bumping understand what u r bumping on about
Title: The Bumpy Thread
Post by: lordly_dragon on January 05, 2006, 04:45:20 PM
bump you all who are against me with ZE BIG MOMA :heh:  
Title: The Bumpy Thread
Post by: OP2Patriot on January 05, 2006, 05:49:55 PM
*bumps CK9 and lordly_dragon into pit*
Title: The Bumpy Thread
Post by: Leviathan on January 05, 2006, 06:18:38 PM
bumpy!!!!!!!!!!!!!!!!!!
Title: The Bumpy Thread
Post by: Betaray on January 05, 2006, 06:52:49 PM
bumpoooooooooooooooo
Title: The Bumpy Thread
Post by: CK9 on January 05, 2006, 08:44:12 PM
hehehe, back at school and bumping with all my cool new stuff

scanner, flash drive, ect.
 
Title: The Bumpy Thread
Post by: OP2Patriot on January 05, 2006, 11:24:09 PM
If thar be no bump today, thar be bump tomorrow or day after. Maybe both.
Title: The Bumpy Thread
Post by: plymoth45 on January 05, 2006, 11:38:15 PM
There shall always be a bump with me around!
Title: The Bumpy Thread
Post by: OP2Patriot on January 06, 2006, 01:11:15 AM
Just bump it.  
Title: The Bumpy Thread
Post by: CK9 on January 06, 2006, 08:52:26 AM
bump it good
Title: The Bumpy Thread
Post by: plymoth45 on January 06, 2006, 10:52:45 AM
bump it very good :P
Title: The Bumpy Thread
Post by: CK9 on January 06, 2006, 01:43:22 PM
what are you bumping on about this time?
Title: The Bumpy Thread
Post by: Mez on January 06, 2006, 03:46:36 PM
bumps mainly!
Title: The Bumpy Thread
Post by: Betaray on January 06, 2006, 03:47:20 PM
I like my bumps
Title: The Bumpy Thread
Post by: lordly_dragon on January 06, 2006, 04:13:23 PM
bump you into the same pit because of a rope that huh... slipped from my hand to your head
Title: The Bumpy Thread
Post by: plymoth45 on January 06, 2006, 11:46:37 PM
oh bump
Title: The Bumpy Thread
Post by: lordly_dragon on January 06, 2006, 11:52:36 PM
i bump girl taht are complicated because of the suffering that they done to ppl  (thumbsdown)  
Title: The Bumpy Thread
Post by: plymoth45 on January 06, 2006, 11:53:44 PM
I bumpin agree there. I need a bumpin girlfriend...
Title: The Bumpy Thread
Post by: Eddy-B on January 07, 2006, 03:27:27 AM
bump
Title: The Bumpy Thread
Post by: lordly_dragon on January 07, 2006, 09:47:02 AM
bump in my stomach  a fat hamburger cuz im hungry
Title: The Bumpy Thread
Post by: Betaray on January 07, 2006, 10:00:39 AM
me bump
Title: The Bumpy Thread
Post by: OP2Patriot on January 07, 2006, 12:24:15 PM
BUMP[/font]
Title: The Bumpy Thread
Post by: plymoth45 on January 07, 2006, 06:03:14 PM
bump
Title: The Bumpy Thread
Post by: lordly_dragon on January 08, 2006, 09:41:23 AM
bumper i had an accident yesterday with my mom aww crap  
Title: The Bumpy Thread
Post by: plymoth45 on January 08, 2006, 02:47:14 PM
oh bump, that bumps
Title: The Bumpy Thread
Post by: Betaray on January 08, 2006, 03:53:42 PM
and I bump, and the crowd goes wild!!
Title: The Bumpy Thread
Post by: plymoth45 on January 08, 2006, 06:27:48 PM
bump! must get Narnia soundtrack! BUMP!
Title: The Bumpy Thread
Post by: CK9 on January 08, 2006, 08:11:37 PM
bump
Title: The Bumpy Thread
Post by: Betaray on January 08, 2006, 08:52:22 PM
im so bumping bored
Title: The Bumpy Thread
Post by: plymoth45 on January 08, 2006, 10:58:06 PM
so bump slow bump because bump of bump conversion bump of bump avi bump to bump dvd bump
Title: The Bumpy Thread
Post by: lordly_dragon on January 09, 2006, 11:34:08 AM
bump some boobies up for me  :heh:  
Title: The Bumpy Thread
Post by: CK9 on January 09, 2006, 01:40:30 PM
lordly's bumping imature
Title: The Bumpy Thread
Post by: lordly_dragon on January 09, 2006, 08:15:32 PM
lordly bumping sadness... so let him laugh for a moment -_-
Title: The Bumpy Thread
Post by: CK9 on January 09, 2006, 11:46:40 PM
bump you :P
Title: The Bumpy Thread
Post by: plymoth45 on January 10, 2006, 11:12:31 AM
bump
Title: The Bumpy Thread
Post by: OP2Patriot on January 10, 2006, 06:22:47 PM
I'm alive and bumping.
Title: The Bumpy Thread
Post by: Betaray on January 10, 2006, 06:29:25 PM
put the bumping defibulator away
Title: The Bumpy Thread
Post by: CK9 on January 10, 2006, 10:16:30 PM
shut your bump hole
Title: The Bumpy Thread
Post by: plymoth45 on January 10, 2006, 10:44:35 PM
i'll bump you to the moon!
Title: The Bumpy Thread
Post by: CK9 on January 10, 2006, 11:31:02 PM
bump it all up
Title: The Bumpy Thread
Post by: plymoth45 on January 10, 2006, 11:46:15 PM
I bump siggies!
Title: The Bumpy Thread
Post by: CK9 on January 11, 2006, 09:06:26 AM
Who bumping hates sig pics?
Title: The Bumpy Thread
Post by: plymoth45 on January 11, 2006, 09:30:48 AM
I didn't say that bump
Title: The Bumpy Thread
Post by: CK9 on January 11, 2006, 01:32:31 PM
I know, but which bumper says that?
Title: The Bumpy Thread
Post by: plymoth45 on January 11, 2006, 10:48:15 PM
No bumpin idea
Title: The Bumpy Thread
Post by: lordly_dragon on January 12, 2006, 11:26:38 AM
bump  
Title: The Bumpy Thread
Post by: CK9 on January 12, 2006, 12:38:01 PM
bump
Title: The Bumpy Thread
Post by: OP2Patriot on January 12, 2006, 03:37:09 PM
bump
Title: The Bumpy Thread
Post by: CK9 on January 12, 2006, 03:43:46 PM
bump
Title: The Bumpy Thread
Post by: Betaray on January 12, 2006, 03:44:14 PM
bump
Title: The Bumpy Thread
Post by: CK9 on January 12, 2006, 03:44:59 PM
bumpidy bump
Title: The Bumpy Thread
Post by: plymoth45 on January 12, 2006, 11:21:21 PM
bumpidy bump bump
Title: The Bumpy Thread
Post by: CK9 on January 13, 2006, 09:35:22 AM
bump
Title: The Bumpy Thread
Post by: lordly_dragon on January 13, 2006, 11:22:04 AM
bumpano beach
Title: The Bumpy Thread
Post by: CK9 on January 13, 2006, 01:31:25 PM
bump
Title: The Bumpy Thread
Post by: OP2Patriot on January 13, 2006, 08:11:05 PM
One bump for all, and all for one bump!
Title: The Bumpy Thread
Post by: Betaray on January 13, 2006, 08:11:49 PM
one small step for bump, one giant leap for bumpkind
Title: The Bumpy Thread
Post by: OP2Patriot on January 13, 2006, 08:27:44 PM
The only thing we have to bump is bump itself!
Title: The Bumpy Thread
Post by: CK9 on January 13, 2006, 08:50:09 PM
bump
Title: The Bumpy Thread
Post by: Betaray on January 13, 2006, 08:57:15 PM
give me liberty or give me bump!!
Title: The Bumpy Thread
Post by: CK9 on January 13, 2006, 09:02:31 PM
bump
Title: The Bumpy Thread
Post by: plymoth45 on January 13, 2006, 11:43:53 PM
kick the bump!
Title: The Bumpy Thread
Post by: Betaray on January 14, 2006, 12:02:09 AM
my only regret is that I have but one bump to serve my country
Title: The Bumpy Thread
Post by: plymoth45 on January 14, 2006, 12:14:29 PM
I bump that
Title: The Bumpy Thread
Post by: Betaray on January 14, 2006, 01:04:26 PM
your money or your bump
Title: The Bumpy Thread
Post by: CK9 on January 14, 2006, 02:12:03 PM
Don't fire 'till you see the bumps of the eyes
Title: The Bumpy Thread
Post by: Betaray on January 14, 2006, 02:46:10 PM
you may fire when ready bumpy
Title: The Bumpy Thread
Post by: lordly_dragon on January 14, 2006, 10:11:11 PM
there is two things that are infinite the universe and the bumpy stupidity but im not sure about the former
Title: The Bumpy Thread
Post by: plymoth45 on January 15, 2006, 12:46:32 AM
interesting bump, it might be true :blink:  
Title: The Bumpy Thread
Post by: Betaray on January 15, 2006, 01:01:40 AM
a bump is a terrible thing to waste
Title: The Bumpy Thread
Post by: CK9 on January 15, 2006, 02:48:55 PM
then why are we wasting the bumps?
Title: The Bumpy Thread
Post by: Betaray on January 15, 2006, 03:34:33 PM
because a bump in the hand is worth 2 in the bush
Title: The Bumpy Thread
Post by: Leviathan on January 15, 2006, 04:06:33 PM
bumpeddddddddd
Title: The Bumpy Thread
Post by: lordly_dragon on January 15, 2006, 04:07:11 PM
albert einstein bumped that one ;)
Title: The Bumpy Thread
Post by: CK9 on January 15, 2006, 11:09:24 PM
bump
Title: The Bumpy Thread
Post by: Betaray on January 16, 2006, 09:47:26 PM
so bump...or bump?
Title: The Bumpy Thread
Post by: CK9 on January 17, 2006, 12:35:08 AM
I want the bumpiest one ya got!
Title: The Bumpy Thread
Post by: plymoth45 on January 17, 2006, 09:07:11 AM
ok, biggest bump he has comin right up.....
Title: The Bumpy Thread
Post by: lordly_dragon on January 17, 2006, 11:36:59 AM
BUMP[/i][/u]
Title: The Bumpy Thread
Post by: CK9 on January 17, 2006, 09:58:33 PM
That's your biggest bump?
Title: The Bumpy Thread
Post by: plymoth45 on January 17, 2006, 10:31:48 PM
oh bump, I was hoping for bigger..
Title: The Bumpy Thread
Post by: CK9 on January 17, 2006, 10:58:04 PM
bump
Title: The Bumpy Thread
Post by: plymoth45 on January 18, 2006, 09:17:27 AM
bump
Title: The Bumpy Thread
Post by: CK9 on January 18, 2006, 01:28:39 PM
bump
Title: The Bumpy Thread
Post by: Sl0vi on January 18, 2006, 02:51:52 PM
bump
Title: The Bumpy Thread
Post by: plymoth45 on January 18, 2006, 03:49:08 PM
back to the single bump....
MULTI BUMP TIME!!

B[/b][/size]
Title: The Bumpy Thread
Post by: CK9 on January 18, 2006, 04:32:43 PM
U[/i][/b]

it's bumpalicious
Title: The Bumpy Thread
Post by: plymoth45 on January 19, 2006, 09:22:16 AM
BUM

Only one more letter to go.... who will get the finail bump
Title: The Bumpy Thread
Post by: CK9 on January 19, 2006, 09:41:15 AM
Who do you bumping think?

P[/b][/i][/u]
Title: The Bumpy Thread
Post by: Mez on January 19, 2006, 09:46:54 AM
bump is what i think?

Am i right?
am i?
Title: The Bumpy Thread
Post by: plymoth45 on January 19, 2006, 11:37:51 AM
i don't bump
Title: The Bumpy Thread
Post by: Betaray on January 19, 2006, 01:32:46 PM
well bump me silly and call me a bump
Title: The Bumpy Thread
Post by: Sl0vi on January 19, 2006, 05:45:21 PM
bump
Title: The Bumpy Thread
Post by: CK9 on January 20, 2006, 12:23:43 AM
does bumparay mean, "Well dress me silly and call me nancy"?  'Cause we will :P

BUMP!!
Title: The Bumpy Thread
Post by: plymoth45 on January 20, 2006, 10:31:39 AM
Betabump the bumpray :P
Title: The Bumpy Thread
Post by: CK9 on January 20, 2006, 01:22:40 PM
ready to bump it plym?
Title: The Bumpy Thread
Post by: thablkpanda on January 20, 2006, 04:09:21 PM
To bump, or not to bump, that is the question.

Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump, Hump, bump.

Copy/Paste rules.

Christopher Merchant
Bump Enterprises
Title: The Bumpy Thread
Post by: CK9 on January 20, 2006, 05:24:15 PM
Hey!  There will be no bump-humping here!
Title: The Bumpy Thread
Post by: OP2Patriot on January 21, 2006, 05:05:28 PM
"Let's bump up this place and go home!" - Han Solo, Star Wars: A New Hope.
Title: The Bumpy Thread
Post by: lordly_dragon on January 21, 2006, 06:34:25 PM
i shall bump no fear *jedi rule
Title: The Bumpy Thread
Post by: CK9 on January 22, 2006, 01:49:07 PM
there is no bumping episode were Captain Kirk says "Beam me up Scotty"
Title: The Bumpy Thread
Post by: Sl0vi on January 22, 2006, 07:37:46 PM
bump?
Title: The Bumpy Thread
Post by: Betaray on January 22, 2006, 08:08:04 PM
it was Col. Musbump, in the living bump, with a bumpingstick
Title: The Bumpy Thread
Post by: CK9 on January 22, 2006, 08:15:54 PM
YOu bumped me
Title: The Bumpy Thread
Post by: plymoth45 on January 23, 2006, 09:32:03 AM
yes, he bumped you, that a bump I see?
Title: The Bumpy Thread
Post by: lordly_dragon on January 23, 2006, 11:27:39 AM
bumping 0wnage  
Title: The Bumpy Thread
Post by: plymoth45 on January 23, 2006, 11:27:44 PM
bumping Pwnage!
Title: The Bumpy Thread
Post by: CK9 on January 24, 2006, 08:51:11 AM
*pulls out a bump gun*
asta la vista baby
Title: The Bumpy Thread
Post by: plymoth45 on January 24, 2006, 09:18:35 AM
*Bumps outta the line of fire, leaving LD deadin the sights*
 
Title: The Bumpy Thread
Post by: lordly_dragon on January 24, 2006, 11:38:43 AM
:lol: sigh i was bumbed in that line  
Title: The Bumpy Thread
Post by: CK9 on January 24, 2006, 05:50:33 PM
plym, it's a homing bump :P
Title: The Bumpy Thread
Post by: lordly_dragon on January 24, 2006, 07:31:49 PM
omg bump0zor
Title: The Bumpy Thread
Post by: Sl0vi on January 24, 2006, 08:06:30 PM
hmm.. yeah, you were. bump...
Title: The Bumpy Thread
Post by: plymoth45 on January 24, 2006, 11:01:36 PM
oh bump, i'm bumped lol
Title: The Bumpy Thread
Post by: CK9 on January 25, 2006, 09:06:17 AM
bump off ya hoser
Title: The Bumpy Thread
Post by: lordly_dragon on January 25, 2006, 11:11:15 AM
bump im at school :(
Title: The Bumpy Thread
Post by: CK9 on January 25, 2006, 01:38:40 PM
I bumping am too
Title: The Bumpy Thread
Post by: lordly_dragon on January 25, 2006, 02:15:37 PM
bumpy goody end of week :D ski tomorrow and friday :D:D
Title: The Bumpy Thread
Post by: Eddy-B on January 25, 2006, 03:31:36 PM
(http://www.users.on.net/~mcgor/FlameBait/BUMP.gif)
Title: The Bumpy Thread
Post by: CK9 on January 25, 2006, 04:26:40 PM
Eddy!  That's no way to treat your bumping date!
Title: The Bumpy Thread
Post by: Eddy-B on January 26, 2006, 11:25:00 AM
Quote
Eddy!  That's no way to treat your date!
i vote REMOVAL .. HE DIDN'T bump!
Title: The Bumpy Thread
Post by: lordly_dragon on January 26, 2006, 07:12:57 PM
bump i agree  
Title: The Bumpy Thread
Post by: CK9 on January 27, 2006, 09:56:44 AM
what are you bumping on about?
Title: The Bumpy Thread
Post by: plymoth45 on January 27, 2006, 12:18:13 PM
oh bump, ck is correct!
Title: The Bumpy Thread
Post by: Eddy-B on January 27, 2006, 05:13:48 PM
he cheated! he added BUMP later
Title: The Bumpy Thread
Post by: CK9 on January 27, 2006, 05:42:05 PM
It's not bumping cheating, it's a delayed bump :P
Title: The Bumpy Thread
Post by: Betaray on March 17, 2006, 10:59:13 PM
dude the bump thread is way down here, nobodys bumped in months, whats your problem?

FOR THE LOVE OF PETE BUMP!!!
Title: The Bumpy Thread
Post by: Sl0vi on March 18, 2006, 06:45:34 AM
ok

bump
Title: The Bumpy Thread
Post by: lordly_dragon on March 18, 2006, 09:27:51 AM
if you bump so....
Title: The Bumpy Thread
Post by: instigator on March 18, 2006, 11:17:32 AM
the bump has be reborn!!!
 
Title: The Bumpy Thread
Post by: Betaray on March 18, 2006, 11:35:23 AM
go little bump go!!
Title: The Bumpy Thread
Post by: CK9 on March 18, 2006, 06:52:23 PM
can we get to 100 bumpy pages?
Title: The Bumpy Thread
Post by: Betaray on March 18, 2006, 08:55:09 PM
only if we work really hard on our bumps
Title: The Bumpy Thread
Post by: Sl0vi on March 18, 2006, 08:55:57 PM
let's start bumping away then!
Title: The Bumpy Thread
Post by: CK9 on March 19, 2006, 01:08:03 PM
bump the day away!
Title: The Bumpy Thread
Post by: Sl0vi on March 22, 2006, 10:39:59 AM
better keep bumping this thread
Title: The Bumpy Thread
Post by: lordly_dragon on March 23, 2006, 10:32:38 AM
bump a stupid math test here =(
Title: The Bumpy Thread
Post by: CK9 on March 23, 2006, 10:46:04 AM
I had a bumper of one just no
Title: The Bumpy Thread
Post by: Sl0vi on March 23, 2006, 03:06:57 PM
bump!

c'mon! we can't let the person above me thread catch up with the bumpy thread!
Title: The Bumpy Thread
Post by: Sirbomber on March 23, 2006, 04:12:23 PM
(http://i5.photobucket.com/albums/y197/Sirbomber/bumped.png)
Title: The Bumpy Thread
Post by: CK9 on March 24, 2006, 12:21:25 AM
nice bump bomber
Title: The Bumpy Thread
Post by: lordly_dragon on March 24, 2006, 10:30:49 AM
awsome bomber this was a hell of a bomb :D
 
Title: The Bumpy Thread
Post by: CK9 on March 24, 2006, 12:00:17 PM
that wasn't a bump, lordly
Title: The Bumpy Thread
Post by: lordly_dragon on March 25, 2006, 07:16:43 PM
hum... my mistake I wanted to replace the world BOMB by BUMP oR even just BOMP so ill bump twice just to make sure that I bumped that tread of


ps: BUMP
Title: The Bumpy Thread
Post by: BlackBox on March 30, 2006, 07:20:24 AM
In a while I'll have bumping bumpy statistics.

Like graphs of the bumps over month/weekday/whatever.

And best/worst bumpers, as well as total bumpage for each bumper.

 
Title: The Bumpy Thread
Post by: CK9 on April 01, 2006, 02:50:50 AM
you mean kinda like the one xfir had that one time bumping around which was eventually ignored?
Title: The Bumpy Thread
Post by: TRIX Rabbit on April 01, 2006, 04:46:32 PM
BUMP-tastic! BUMP-riffic! BUMP-tacular!
Title: The Bumpy Thread
Post by: CK9 on April 01, 2006, 05:35:10 PM
bump wars!
Title: The Bumpy Thread
Post by: BlackBox on April 02, 2006, 09:34:50 AM
Quote
you mean kinda like the one xfir had that one time bumping around which was eventually ignored?
Somewhat, yes.

But bumping better.
Title: The Bumpy Thread
Post by: CK9 on April 03, 2006, 07:49:56 AM
bump to that
Title: The Bumpy Thread
Post by: Betaray on April 03, 2006, 06:40:37 PM
keep your friends close, but keep your bumps closer
Title: The Bumpy Thread
Post by: james239 on April 03, 2006, 07:03:30 PM
*bump*
Keepin' it simple.
Title: The Bumpy Thread
Post by: CK9 on April 03, 2006, 09:47:22 PM
|\....|......|...|\..../|...|\
|..|..|......|...|.\../.|...|..|
|/....|......|...|..\/..|...|/
|\....|......|...|.......|..|
|..|..|......|...|.......|..|
|/....\___/|..|.......|...|


I know, it could be better
Title: The Bumpy Thread
Post by: BlackBox on April 13, 2006, 03:36:23 PM
omfb! it bumping bumps!

omfb: oh my f***ing bump.
Title: The Bumpy Thread
Post by: CK9 on April 13, 2006, 06:55:50 PM
it's a big bump
Title: The Bumpy Thread
Post by: plymoth45 on April 15, 2006, 10:35:04 AM
I've seen much bigger bumps
Title: The Bumpy Thread
Post by: Sl0vi on April 15, 2006, 12:17:26 PM
as long as it's a bump it's bump
Title: The Bumpy Thread
Post by: CK9 on April 16, 2006, 05:01:10 PM
plym, thar was bumping wrong, lol
Title: The Bumpy Thread
Post by: Betaray on April 16, 2006, 06:41:39 PM
ahh bump it
Title: The Bumpy Thread
Post by: CK9 on April 17, 2006, 12:08:59 AM
bump you
Title: The Bumpy Thread
Post by: plymoth45 on April 17, 2006, 02:29:20 AM
ck, pull your bumping head outta the gutter :P

EF2 was a bumping good game, wish I new how the story concludes since I know there isn't going to be an EF3
Title: The Bumpy Thread
Post by: BlackBox on April 17, 2006, 05:04:45 AM
OP2 bumping owns it :)

 
Title: The Bumpy Thread
Post by: Betaray on April 17, 2006, 12:19:23 PM
UT2bump4
Title: The Bumpy Thread
Post by: CK9 on April 18, 2006, 08:34:52 AM
WHOSE head is in the gutter, plym?  It bumps to me tha it is you for assuming it like that...
Title: The Bumpy Thread
Post by: plymoth45 on April 18, 2006, 09:22:09 PM
well what did you bumping mean?
Title: The Bumpy Thread
Post by: CK9 on April 19, 2006, 07:40:55 AM
I could have bumped think...torch...anyof a number of bumping things
Title: The Bumpy Thread
Post by: BlackBox on April 19, 2006, 01:44:03 PM
bump?

what?

lol
Title: The Bumpy Thread
Post by: CK9 on April 19, 2006, 03:21:29 PM
bump attack of spam dominance!
Title: The Bumpy Thread
Post by: Sl0vi on April 19, 2006, 04:01:16 PM
.-.-.-.-.-.-
.- bump.-
.-.-.-.-.-.-
Title: The Bumpy Thread
Post by: Freeza-CII on August 09, 2006, 01:42:35 PM
GOD DAMN IT BUMP BUMP BUMP BUMPPITY BUMP BUMP

Been to bumping long sence there was a Bumping bump post
Title: The Bumpy Thread
Post by: Betaray on August 09, 2006, 03:19:58 PM
Damn its been a while since my last bump

I hope I remember how to bump
Title: The Bumpy Thread
Post by: Sl0vi on August 09, 2006, 03:44:03 PM
I've been waiting so long for someone to bump so I could bump again! :D
Title: The Bumpy Thread
Post by: Freeza-CII on August 09, 2006, 05:34:45 PM
like a five month lag between the posts lol then they got buried

Bike are very cool contraptions
Uranium is better to lick then jumbo jawbreakers
Meteors slightly bigger then the CC will fall on the tracking device i put in your pants.
Positron colliders were used in ghost busters
Title: The Bumpy Thread
Post by: Betaray on August 09, 2006, 05:36:54 PM
buried the bump thread?

quick hide the eggs!!!
Title: The Bumpy Thread
Post by: Freeza-CII on August 09, 2006, 05:38:36 PM
Ya remember all them ridels and such then other stuff that was put in the spam section. the Bump thread was just kinda buired under all that.  And where the hell is CK9 he needs to bump i am sure he would love it.
Title: The Bumpy Thread
Post by: CK9 on August 09, 2006, 05:44:42 PM
*bumps freeza into a bottomless pit*

yeah, he was right, I did enjoy that
Title: The Bumpy Thread
Post by: Freeza-CII on August 09, 2006, 05:48:03 PM
more people should bump
Title: The Bumpy Thread
Post by: Betaray on August 09, 2006, 07:06:31 PM
if only the knew the pleasure of bumping

ohhh yea
Title: The Bumpy Thread
Post by: Chandler on August 09, 2006, 07:22:49 PM
Code: [Select]
|----\     |     |      ^   ^       |----\
|     |    |     |    /  \/   \     |     |
|----<     |     |    |   |   |     |----/
|     |    |     |    |   |   |     |
|----/     \-----/    |   |   |     |
Title: The Bumpy Thread
Post by: Leviathan on August 10, 2006, 01:19:15 AM
bump :o
Title: The Bumpy Thread
Post by: Sl0vi on August 10, 2006, 01:50:52 PM
pmub
Title: The Bumpy Thread
Post by: Eddy-B on August 10, 2006, 11:05:00 PM
¿BUMP?
Title: The Bumpy Thread
Post by: Freeza-CII on August 12, 2006, 12:47:20 PM
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
Title: The Bumpy Thread
Post by: Betaray on August 12, 2006, 12:55:43 PM
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
Title: The Bumpy Thread
Post by: CK9 on August 13, 2006, 05:40:54 PM
NOW LOOK WHAT YOU BUMPING DID FREEZA!
Title: The Bumpy Thread
Post by: Betaray on August 13, 2006, 05:48:24 PM
HA I HAVE REVERTED TO MY OLD BUMPY WAYS!!

PHEAR MY BUMPS!! (expecially that weard little purple one that smells funny)
Title: The Bumpy Thread
Post by: Sl0vi on August 14, 2006, 08:59:37 AM
lol, sure are alot of bumps in that post
Title: The Bumpy Thread
Post by: BlackBox on August 14, 2006, 01:10:56 PM
http://forum.outpostuniverse.net/bump.php (http://forum.outpostuniverse.net/bump.php)

somewhat broken bump thread statistics. (well, the graphs are broken)

bump !
Title: The Bumpy Thread
Post by: CK9 on August 14, 2006, 06:01:05 PM
no one bumps more than me, muahahahaha!!!! though, I got to find those 6 bumpless posts...
Title: The Bumpy Thread
Post by: Betaray on August 14, 2006, 06:23:23 PM
does it recognise askii bumps? or more creative bumps that a human can read, but a computer cant?

like

BU
MP?
Title: The Bumpy Thread
Post by: CK9 on August 14, 2006, 06:27:29 PM
umm..is it the same one that x used?  If so, I dun think so
Title: The Bumpy Thread
Post by: Sl0vi on August 14, 2006, 06:50:54 PM
the statistics lie! All my posts contains bumps!
Title: The Bumpy Thread
Post by: Chandler on August 14, 2006, 07:28:59 PM
Damn stats lie - ASCII bumps rule!

BuMp BuMp
Title: The Bumpy Thread
Post by: CK9 on August 14, 2006, 08:19:30 PM
lobumpingl
Title: The Bumpy Thread
Post by: Betaray on August 14, 2006, 08:56:52 PM
I must bump the bump thread to the bumping top!!

oh wait, it was already at the top, please disregard this bump
Title: The Bumpy Thread
Post by: dm-horus on August 15, 2006, 12:47:08 AM
wtf is a bump?
Title: The Bumpy Thread
Post by: Chandler on August 15, 2006, 06:25:43 AM
:bump:
:anibump:
Heheheheh.... bump just to make sure.

 :I'm with stupid:  
Title: The Bumpy Thread
Post by: BlackBox on August 15, 2006, 06:56:26 AM
The bumping statistics only count

bump

or any capitalization of that.

but not
BU
MP

or

B U M P

or anything of that sort.
Title: The Bumpy Thread
Post by: Betaray on August 15, 2006, 07:58:53 AM
B to the

U to the

UMP

ok, so it dosnt spell Bump but it sounds cool
Title: The Bumpy Thread
Post by: Freeza-CII on August 15, 2006, 02:02:26 PM
bump is like marklar lol  
Title: The Bumpy Thread
Post by: dm-horus on August 15, 2006, 02:51:18 PM
we refer to all people places and things as bump?
Title: The Bumpy Thread
Post by: Freeza-CII on August 15, 2006, 06:52:56 PM
that is correct bump
Title: The Bumpy Thread
Post by: CK9 on August 16, 2006, 07:45:51 AM
so I don;t have anybumpless posts
Title: The Bumpy Thread
Post by: BlackBox on August 16, 2006, 08:43:08 AM
oh but you do..

Quote
Most non-bumps (7):
CK9

:P

oops, almost forgot .. BUMP
Title: The Bumpy Thread
Post by: Sl0vi on August 16, 2006, 10:09:06 AM
bump
Title: The Bumpy Thread
Post by: Freeza-CII on August 16, 2006, 10:18:18 AM
bump bump bump
Title: The Bumpy Thread
Post by: CK9 on August 16, 2006, 04:40:22 PM
actually, hacker, all those non bumbs are ASCII, split bumps, and word-spliced bumps, therefore the count is really 0
Title: The Bumpy Thread
Post by: Betaray on August 16, 2006, 05:18:28 PM
dang, no anagrams for bump
Title: The Bumpy Thread
Post by: Chandler on August 16, 2006, 07:25:08 PM
:spam:

"Greetings, Your Bumpiness" said the toad....

:Betaray: :CK9's: Bump (...)

:x: :evil laugh:
Title: The Bumpy Thread
Post by: CK9 on August 16, 2006, 07:56:17 PM
beta, you forget the M Pub, where every drink is a bump to your liver
Title: The Bumpy Thread
Post by: Betaray on August 16, 2006, 08:57:47 PM
:Betaray: Bump

I forgot about my own bump smily lol

kick ass
Title: The Bumpy Thread
Post by: Freeza-CII on August 17, 2006, 01:55:23 AM
pmubumpmubumpmubumpmubumpmubumpmubumpmubumpmubumpmubumpmubumpmub
Title: The Bumpy Thread
Post by: Mez on August 17, 2006, 04:47:56 AM
y cant people just say "bump?"
Title: The Bumpy Thread
Post by: Leviathan on August 17, 2006, 05:19:07 AM
i can

bump
Title: The Bumpy Thread
Post by: CK9 on August 17, 2006, 07:34:58 AM
but just saying bump gets boring.  You have to spice up the bump
Title: The Bumpy Thread
Post by: Betaray on August 17, 2006, 08:46:26 AM
bump! spice that up a notch!!
Title: The Bumpy Thread
Post by: BlackBox on August 17, 2006, 10:02:38 AM
spicy bumps

5 and a half red peppers.
Title: The Bumpy Thread
Post by: Freeza-CII on August 17, 2006, 11:55:00 AM
plump bumps with stuffing :D
Title: The Bumpy Thread
Post by: Betaray on August 17, 2006, 03:37:55 PM
*bump* excuse me

man that one is ripe!!
Title: The Bumpy Thread
Post by: Sl0vi on August 17, 2006, 03:51:46 PM
bump
Title: The Bumpy Thread
Post by: Freeza-CII on August 17, 2006, 04:15:52 PM
finally a new page of bumps
Title: The Bumpy Thread
Post by: Sl0vi on August 17, 2006, 04:55:05 PM
Let's celebrate that by bumping up to yet another page!
Title: The Bumpy Thread
Post by: BlackBox on August 17, 2006, 07:00:04 PM
BUMP on the camel's back.

It's full of Fat not water.
Title: The Bumpy Thread
Post by: Freeza-CII on August 17, 2006, 08:12:56 PM
thats a Bumping lie its well known that hump is used to transport cocain
Title: The Bumpy Thread
Post by: BlackBox on August 18, 2006, 04:54:42 AM
haha

Bump with a Laser Lynx
Title: The Bumpy Thread
Post by: Sl0vi on August 18, 2006, 01:14:26 PM
bump
Title: The Bumpy Thread
Post by: Savant 231-A on August 20, 2006, 05:37:36 AM
:anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:
Hope you are happy about this  :bump: If not: Du kannst frei gehen mit Erde zu bedecken  :lol:  :P  
Title: The Bumpy Thread
Post by: CK9 on August 20, 2006, 05:55:43 PM
Bump you with a zit!
Title: The Bumpy Thread
Post by: Chandler on August 20, 2006, 07:30:14 PM
Ow! Don't bump my lump :CK9's:  
Title: The Bumpy Thread
Post by: CK9 on August 21, 2006, 07:31:59 AM
I have bumps all inside me and they're gunna pop
Title: The Bumpy Thread
Post by: Betaray on August 21, 2006, 09:35:22 AM
should, I bump? I dont really feel like bumping, but its so tempting

ahh bump it
Title: The Bumpy Thread
Post by: Sl0vi on August 21, 2006, 10:19:08 AM
bump !
Title: The Bumpy Thread
Post by: BlackBox on August 21, 2006, 11:32:52 AM
Sump pump bump :P

(Yes, I know what its like when the sump pump fails.. the basement fills up with water :-/)
Title: The Bumpy Thread
Post by: CK9 on August 21, 2006, 01:10:16 PM
sump pump?  WTF is that?

bump
Title: The Bumpy Thread
Post by: Betaray on August 21, 2006, 01:29:37 PM
it pumps your sump bump dump duh
Title: The Bumpy Thread
Post by: CK9 on August 21, 2006, 08:27:50 PM
you don't bumping know, do you?
Title: The Bumpy Thread
Post by: Sl0vi on August 24, 2006, 04:32:10 AM
bump!
Title: The Bumpy Thread
Post by: BlackBox on August 24, 2006, 05:45:19 AM
A sump pump's generally used in basements, especially those where the water table is really high.

the basement is so low that water can leach from the ground into the basement through minute cracks as the groundwater level rises.. and it can flood.

A sump pump bump (agh! cant keep my sump, pump, and bump straight!) is set in a hole in the basement floor which ends up being the lowest place in the basement. (Thus the place where water collects first). The pump forces water out of this hole out a pipe away from the house, protecting the basement.

If the pump fails then that hole will eventually overflow and water will start pooling on the floor in the basement.

Anyway, enough about bumping sump pumps, eh?
Title: The Bumpy Thread
Post by: CK9 on August 24, 2006, 06:57:08 AM
how about bumping hackers?
Title: The Bumpy Thread
Post by: Sl0vi on August 24, 2006, 03:23:09 PM
bump
Title: The Bumpy Thread
Post by: CK9 on August 24, 2006, 05:07:50 PM
bump
Title: The Bumpy Thread
Post by: Freeza-CII on August 24, 2006, 05:08:54 PM
*Tosses the H-Bump to CK9*
Title: The Bumpy Thread
Post by: Betaray on August 24, 2006, 06:55:42 PM
cool bump
Title: The Bumpy Thread
Post by: op2rules on August 25, 2006, 03:52:40 PM
bump
Title: The Bumpy Thread
Post by: Sl0vi on August 26, 2006, 09:03:05 PM
bump ! :D adfaedf
Title: The Bumpy Thread
Post by: CK9 on August 26, 2006, 09:48:31 PM
bump
Title: The Bumpy Thread
Post by: Betaray on August 26, 2006, 09:54:56 PM
pmub
Title: The Bumpy Thread
Post by: CK9 on August 27, 2006, 09:20:14 AM
in the world of betaray, bump is an answer to almost any question
Title: The Bumpy Thread
Post by: Chandler on August 27, 2006, 07:21:17 PM
Quote
pmub
Too bad your rear bumps don't count in the bump sum :D  
Title: The Bumpy Thread
Post by: Sl0vi on August 29, 2006, 02:03:56 PM
bump
Title: The Bumpy Thread
Post by: BlackBox on August 29, 2006, 02:34:39 PM
(http://hacker.outpostuniverse.net/mapper-bump.png)

OP2Mapper 3 code bump :D (no, it's not real code. It's something I typed up really fast).

http://forum.outpostuniverse.net/index.ph...=24&#entry51753 (http://forum.outpostuniverse.net/index.php?showtopic=2813&st=24&#entry51753)
for screenshots of the actual program (too bad they don't say BUMP!)
Title: The Bumpy Thread
Post by: Stormy on August 29, 2006, 09:42:07 PM
buuuuummmpp!
Title: The Bumpy Thread
Post by: CK9 on August 30, 2006, 07:44:06 AM
YOu should bumping add bump somewhere as an egg
Title: The Bumpy Thread
Post by: Sl0vi on August 30, 2006, 11:46:59 AM
yeah, eggs are fun, especially when they're bumps
Title: The Bumpy Thread
Post by: Freeza-CII on August 30, 2006, 12:32:10 PM
how much can a bumpbump bump if a bumpbump could bump some
Z=A(B/U)^m+p
Title: The Bumpy Thread
Post by: CK9 on August 31, 2006, 07:33:04 AM
your bump logic is infallable!
 
Title: The Bumpy Thread
Post by: Freeza-CII on August 31, 2006, 08:01:39 AM
my bump drive performs 500^50 mega bumps a second  
Title: The Bumpy Thread
Post by: Sl0vi on August 31, 2006, 09:26:46 AM
wow, that's alot of mega bumps  :blink:  
Title: The Bumpy Thread
Post by: CK9 on August 31, 2006, 09:44:17 AM
humble your bump!
Title: The Bumpy Thread
Post by: Sl0vi on August 31, 2006, 10:46:05 AM
bump
Title: The Bumpy Thread
Post by: BlackBox on August 31, 2006, 12:05:42 PM
The bumping mapper will have a bumping egg somewhere.

Not sure if it will be a BUMPING egg, but there will be a bumping egg.
Title: The Bumpy Thread
Post by: Sl0vi on August 31, 2006, 01:13:25 PM
sounds like bumping fun! :D
Title: The Bumpy Thread
Post by: CK9 on August 31, 2006, 06:31:51 PM
will it be a bumping game inside of it like word 97 had?
Title: The Bumpy Thread
Post by: Chandler on August 31, 2006, 08:02:23 PM
What bumping bumping game that you bump in bumping Word 97?
Title: The Bumpy Thread
Post by: Betaray on August 31, 2006, 08:21:35 PM
op3 should have a bumper egg
Title: The Bumpy Thread
Post by: Sl0vi on September 01, 2006, 02:30:45 PM
bump
Title: The Bumpy Thread
Post by: Betaray on September 01, 2006, 02:36:52 PM
some bumping dog likes to eat the catfood
Title: The Bumpy Thread
Post by: Mez on September 01, 2006, 04:39:53 PM
some bumping cats own dogs
Title: The Bumpy Thread
Post by: Sl0vi on September 01, 2006, 09:41:32 PM
bump
Title: The Bumpy Thread
Post by: CK9 on September 03, 2006, 10:04:39 AM
bump a little dance, bump a little love, bump down tonight
Title: The Bumpy Thread
Post by: Betaray on September 03, 2006, 11:03:57 AM
oh I wish I was an oscar myer bumper!! that is what I really like to bump
Title: The Bumpy Thread
Post by: Chandler on September 03, 2006, 07:22:39 PM
OPU bumperstickers for everyone who has said bump in this Bumpy Thread...
Title: The Bumpy Thread
Post by: Sl0vi on September 04, 2006, 03:19:20 PM
bump to that
Title: The Bumpy Thread
Post by: Betaray on September 04, 2006, 03:36:08 PM
bump the google bot
Title: The Bumpy Thread
Post by: Sl0vi on September 04, 2006, 04:10:05 PM
BUMP
Title: The Bumpy Thread
Post by: Chandler on September 04, 2006, 07:20:20 PM
Bump me some more bumping bump post ore !
Title: The Bumpy Thread
Post by: Freeza-CII on September 04, 2006, 11:22:14 PM
now Bump till your bump just gets to sore.
Title: The Bumpy Thread
Post by: Sl0vi on September 05, 2006, 02:26:44 PM
bump
Title: The Bumpy Thread
Post by: Betaray on September 05, 2006, 02:45:52 PM
THE BUMPS!!!!
Title: The Bumpy Thread
Post by: Sl0vi on September 05, 2006, 04:17:05 PM
goosebumps :D
Title: The Bumpy Thread
Post by: BlackBox on September 06, 2006, 05:51:49 PM
THE ORES!!!!

bump
Title: The Bumpy Thread
Post by: Stormy on September 06, 2006, 07:26:04 PM
Your mom bumps (lame joke i know xD)
Title: The Bumpy Thread
Post by: Betaray on September 06, 2006, 07:33:40 PM
in bump
Title: The Bumpy Thread
Post by: Stormy on September 06, 2006, 08:48:20 PM
She'll come bumping around the mountain when she comes....
Title: The Bumpy Thread
Post by: Betaray on September 06, 2006, 08:59:11 PM
ring around the bump
Title: The Bumpy Thread
Post by: Stormy on September 06, 2006, 09:01:15 PM
BUMP TO THE RIGHT!! BUMP TO THE LEFT!!!  
Title: The Bumpy Thread
Post by: Betaray on September 06, 2006, 09:04:43 PM
bump'em when their up, bump'em when their down
Title: The Bumpy Thread
Post by: CK9 on September 07, 2006, 03:05:37 AM
bump
Title: The Bumpy Thread
Post by: Sl0vi on September 07, 2006, 08:59:00 AM
bump
Title: The Bumpy Thread
Post by: BlackBox on September 07, 2006, 12:51:09 PM
boat bumpers
Title: The Bumpy Thread
Post by: Betaray on September 07, 2006, 12:56:37 PM
use the buildge bump!!!
Title: The Bumpy Thread
Post by: Savant 231-A on September 08, 2006, 10:48:18 AM
All give ya all a nice BumpyNuke.
Happy Bump.
Title: The Bumpy Thread
Post by: Sl0vi on September 08, 2006, 11:38:04 AM
happy bump to you too :P
Title: The Bumpy Thread
Post by: CK9 on September 08, 2006, 12:30:45 PM
bump you with a super
Title: The Bumpy Thread
Post by: Galactic on September 08, 2006, 10:44:15 PM
The car went bump when it fell on a hump. The hump made a sound like a whomp. The only reason this happened is because the car went bump.
Title: The Bumpy Thread
Post by: CK9 on September 09, 2006, 06:04:48 PM
bump
Title: The Bumpy Thread
Post by: Betaray on September 09, 2006, 06:28:51 PM
iBump
Title: The Bumpy Thread
Post by: Sl0vi on September 09, 2006, 07:35:15 PM
bump
Title: The Bumpy Thread
Post by: CK9 on September 11, 2006, 08:39:56 PM
bump
Title: The Bumpy Thread
Post by: Sl0vi on September 13, 2006, 03:50:31 PM
bump
Title: The Bumpy Thread
Post by: Chandler on September 13, 2006, 07:47:31 PM
bump
Title: The Bumpy Thread
Post by: CK9 on September 14, 2006, 12:13:25 AM
bump
Title: The Bumpy Thread
Post by: Sl0vi on September 15, 2006, 09:33:42 AM
bump
Title: The Bumpy Thread
Post by: CK9 on September 15, 2006, 10:34:35 AM
bump
Title: The Bumpy Thread
Post by: Sl0vi on September 18, 2006, 09:05:14 AM
c'mon people, keep bumping!
Title: The Bumpy Thread
Post by: Betaray on September 18, 2006, 11:25:56 AM
Sen. Bump
Title: The Bumpy Thread
Post by: Sl0vi on September 18, 2006, 11:55:15 AM
bump! :D
Title: The Bumpy Thread
Post by: Chandler on September 18, 2006, 07:33:20 PM
Sonic Bump!
Title: The Bumpy Thread
Post by: Arklon on September 18, 2006, 07:38:48 PM
z-bump
Title: The Bumpy Thread
Post by: Sl0vi on September 21, 2006, 05:35:27 PM
bump
Title: The Bumpy Thread
Post by: Betaray on September 21, 2006, 05:55:17 PM
cell bump
Title: The Bumpy Thread
Post by: Arklon on September 21, 2006, 05:59:09 PM
Cold fusion-powered bump.
Title: The Bumpy Thread
Post by: Sl0vi on September 21, 2006, 07:02:08 PM
titaenum bump
Title: The Bumpy Thread
Post by: Chandler on September 21, 2006, 07:29:30 PM
Hadoken Bump!
Title: The Bumpy Thread
Post by: Betaray on September 21, 2006, 07:40:17 PM
melted UFO bump
Title: The Bumpy Thread
Post by: Freeza-CII on September 21, 2006, 10:54:31 PM
mettle bump
Title: The Bumpy Thread
Post by: CK9 on September 24, 2006, 06:08:40 PM
betasandwich bump
Title: The Bumpy Thread
Post by: Chandler on September 24, 2006, 07:15:34 PM
isosandwich bump
Title: The Bumpy Thread
Post by: Leviathan on September 25, 2006, 05:20:59 AM
standard bump :o
Title: The Bumpy Thread
Post by: lordly_dragon on September 25, 2006, 07:08:02 AM
Hawk bump!
Title: The Bumpy Thread
Post by: Savant 231-A on September 25, 2006, 10:23:49 AM
*BUMP*
Ups, my bump!
Title: The Bumpy Thread
Post by: CK9 on September 25, 2006, 01:28:16 PM
bump
Title: The Bumpy Thread
Post by: Sl0vi on September 26, 2006, 10:18:23 AM
BUMP!!!! :D :D  :D ;P 1111 one two three BUMP!
Title: The Bumpy Thread
Post by: lordly_dragon on September 26, 2006, 03:18:24 PM
A ZIIIIING A BUMP!
Title: The Bumpy Thread
Post by: Chandler on September 26, 2006, 07:19:36 PM
1... 2... 3... HAPPY BUMPDAY!

A la BuMp :bump:
Title: The Bumpy Thread
Post by: Sl0vi on September 27, 2006, 01:42:42 PM
one more bump to 900! :D
Title: The Bumpy Thread
Post by: CK9 on September 28, 2006, 03:59:53 PM
Send in the bumps!
Title: The Bumpy Thread
Post by: Sl0vi on September 28, 2006, 04:54:13 PM
let's celebrate the 900 bumps! :D

free mettle for everyone! :D
Title: The Bumpy Thread
Post by: lordly_dragon on September 28, 2006, 07:14:44 PM
brum brum bump
Title: The Bumpy Thread
Post by: Chandler on September 28, 2006, 07:30:46 PM
My 64th post shall be:

BUMP

B U M P

B  U  M  P

:bump:

B  U  M  P

B U M P

BUMP
Title: The Bumpy Thread
Post by: Sl0vi on September 30, 2006, 07:47:15 PM
BUMP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!HFAPOIBHEF=(/"G#=)(&
Title: The Bumpy Thread
Post by: Savant 231-A on October 01, 2006, 01:15:57 AM
Bathroom toilet bump
Title: The Bumpy Thread
Post by: Sl0vi on October 01, 2006, 02:38:42 AM
bump
Title: The Bumpy Thread
Post by: Savant 231-A on October 01, 2006, 08:55:42 AM
Speed of sound BUMP
Title: The Bumpy Thread
Post by: CK9 on October 01, 2006, 10:32:55 AM
bvump
Title: The Bumpy Thread
Post by: Sl0vi on October 01, 2006, 01:16:27 PM
bump
Title: The Bumpy Thread
Post by: Chandler on October 01, 2006, 07:31:38 PM
Da bump is in da house
Title: The Bumpy Thread
Post by: Sl0vi on October 02, 2006, 10:31:23 AM
bump
Title: The Bumpy Thread
Post by: CK9 on October 02, 2006, 08:10:23 PM
Is this still the first bumpy thread?
Title: The Bumpy Thread
Post by: Chandler on October 03, 2006, 07:29:25 PM
The One - The Only - The BUMP

:bump:
Title: The Bumpy Thread
Post by: TRIX Rabbit on October 04, 2006, 05:52:38 PM
Code: [Select]
BUMPBUMPBUMP
BUMP                BUMP
BUMP                BUMP
BUMP                BUMP
BUMPBUMPBUMP
BUMP                BUMP
BUMP                BUMP
BUMP                BUMP
BUMPBUMPBUMP

BUMP                BUMP
BUMP                BUMP
BUMP                BUMP
BUMP                BUMP
BUMP                BUMP
BUMP                BUMP
BUMP                BUMP
BUMP                BUMP
        BUMPBUMP

BUMPBUMP        BUMPBUMP
BUMP        BUMP        BUMP
BUMP        BUMP        BUMP
BUMP        BUMP        BUMP
BUMP        BUMP        BUMP
BUMP        BUMP        BUMP
BUMP        BUMP        BUMP
BUMP        BUMP        BUMP
BUMP        BUMP        BUMP

BUMPBUMPBUMP
BUMP                BUMP
BUMP                BUMP
BUMP                BUMP
BUMPBUMPBUMP
BUMP
BUMP
BUMP
BUMP
Title: The Bumpy Thread
Post by: CK9 on October 05, 2006, 07:47:16 AM
your bumps are a little off
Title: The Bumpy Thread
Post by: TRIX Rabbit on October 05, 2006, 02:23:15 PM
no one's bumping perfect ck9. bump
Title: The Bumpy Thread
Post by: CK9 on October 06, 2006, 10:56:01 AM
bump you
Title: The Bumpy Thread
Post by: Sl0vi on October 06, 2006, 11:37:07 AM
wow, that was a nice bump
Title: The Bumpy Thread
Post by: lordly_dragon on October 06, 2006, 09:09:41 PM
ascii BUmP!
 
Title: The Bumpy Thread
Post by: Sl0vi on October 07, 2006, 07:34:41 AM
bump
Title: The Bumpy Thread
Post by: Chandler on October 08, 2006, 07:12:09 PM
Emoticon Bump:

:bump:

hehhehhehheh
Title: The Bumpy Thread
Post by: Sl0vi on October 09, 2006, 09:23:06 AM
bump
Title: The Bumpy Thread
Post by: Savant 231-A on October 09, 2006, 10:45:50 AM
Title: The Bumpy Thread
Post by: CK9 on October 11, 2006, 07:43:13 AM
bump eggs
Title: The Bumpy Thread
Post by: TRIX Rabbit on October 14, 2006, 12:36:53 PM
Quote
Bump

wow, that bump was deep right guys? bump
Title: The Bumpy Thread
Post by: CK9 on October 14, 2006, 01:10:23 PM
bum



p
Title: The Bumpy Thread
Post by: TRIX Rabbit on October 14, 2006, 01:51:07 PM
That bump wasnt a real bump CK9! that was a fake/lamer/CK8 bump. BUMP
Title: The Bumpy Thread
Post by: Savant 231-A on October 15, 2006, 12:27:01 AM
Title: The Bumpy Thread
Post by: Chandler on October 15, 2006, 07:30:36 PM
Stop the bumps already!
Title: The Bumpy Thread
Post by: TRIX Rabbit on October 15, 2006, 07:35:51 PM
Stop the Bumps? What'chu talkin bout willis? These BUMPS ARE AWSOME

All you Bump are belong to us...
Title: The Bumpy Thread
Post by: CK9 on October 16, 2006, 07:36:23 AM
Trix, I could out-bump you any day of the week, even the imaginary ones!
Title: The Bumpy Thread
Post by: Sl0vi on October 16, 2006, 09:46:23 AM
bump
Title: The Bumpy Thread
Post by: Mez on October 16, 2006, 12:29:10 PM
bump?
Title: The Bumpy Thread
Post by: Hooman on October 16, 2006, 03:14:53 PM
You know, bumping Monday + i*Tuesday.
Title: The Bumpy Thread
Post by: Brazilian Fan on October 16, 2006, 03:36:21 PM
PMUB<->BUMP
Title: The Bumpy Thread
Post by: Chandler on October 16, 2006, 07:18:58 PM
Quote
You know, bumping Monday + i*Tuesday.
Can a computer multiply a day of the week with an imaginary number?

I dunno, but bump the hell ';...;'
Title: The Bumpy Thread
Post by: Hooman on October 17, 2006, 03:43:20 PM
Quote
Trix, I could out-bump you any day of the week, even the imaginary ones!

I just assumed CK9 was bumping onto something here.
 
Title: The Bumpy Thread
Post by: CK9 on October 17, 2006, 06:59:45 PM
bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump
Title: The Bumpy Thread
Post by: CK9 on October 17, 2006, 07:04:25 PM
bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump bump
Title: The Bumpy Thread
Post by: Chandler on October 17, 2006, 07:10:27 PM
Bumpalicious B)
Title: The Bumpy Thread
Post by: Savant 231-A on October 18, 2006, 11:07:27 AM
HOLY BUMP
That is the biggest BUMP in my whole life
Here is a BUMP
 :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  :anibump:  

The 3rd Bump Army Division
Title: The Bumpy Thread
Post by: Chandler on October 18, 2006, 07:28:29 PM
Thats a lot of :bump:s

Bumpy bump :D
Title: The Bumpy Thread
Post by: CK9 on October 18, 2006, 10:55:22 PM
I had to trim my bump down 5 times just to post it
Title: The Bumpy Thread
Post by: dm-horus on October 19, 2006, 03:31:51 AM
Code: [Select]

      :::::::::  :::    :::   :::   :::   :::::::::  :::
     :+:    :+: :+:    :+:  :+:+: :+:+:  :+:    :+: :+:  
    +:+    +:+ +:+    +:+ +:+ +:+:+ +:+ +:+    +:+ +:+  
   +#++:++#+  +#+    +:+ +#+  +:+  +#+ +#++:++#+  +#+    
  +#+    +#+ +#+    +#+ +#+       +#+ +#+        +#+    
 #+#    #+# #+#    #+# #+#       #+# #+#                
#########   ########  ###       ### ###        ###      
                                  
Title: The Bumpy Thread
Post by: lordly_dragon on October 19, 2006, 07:53:49 AM
Quote
well, lets see how long it takes us to make 100 pages of bumps

starting........

BUMP
this will take a hell of a bump time
Title: The Bumpy Thread
Post by: Chandler on October 19, 2006, 07:24:10 PM
Then lets get bumping :D
Title: The Bumpy Thread
Post by: Hooman on October 20, 2006, 12:53:01 AM
What a bumping waste of space.
 
Title: The Bumpy Thread
Post by: Sl0vi on October 20, 2006, 10:25:46 AM
:blink: bump
Title: The Bumpy Thread
Post by: Savant 231-A on October 20, 2006, 11:30:21 AM
为什么是做爆沸? 由 题目, 我们 必须碰撞爆沸爆沸爆沸 让 它将是困难有纯净的爆沸50 页和更加坚硬有纯净的爆沸sooooo 100 页。我做了语言爆沸! 有将是12 语言爆沸(和这些词太) 。爆沸爆沸爆沸爆沸爆沸爆沸爆沸爆沸爆沸爆沸爆沸爆沸
CHINESE

Waarom zijn maakt een buil? Door het onderwerp van Leviathan, hebben wij/moeten de BUIL van de BUIL van de BUIL moeten STOTEN ahem... laten we continioue, zal het moeilijk zijn om 50 pagina's van zuivere BUIL te hebben en moeilijker om 100 pagina's van zuivere sooooo van de BUIL te hebben. ik maakte de BUIL van de TAAL! Er zal 10 BUILEN zijn van de TAAL (en deze woorden ook). BUIL BUIL BUIL BUIL BUIL BUIL BUIL BUIL BUIL BUIL BUIL BUIL
DUTCH

Pourquoi soyez fasse une bosse ? Par la matière de Leviathan, que nous have/must doivent FRAPPER l'ahem de BOSSE de BOSSE de BOSSE... nous laissons continioue, il sera difficile d'avoir 50 pages de BOSSE pure et plus dur pour avoir 100 pages de sooooo pur de BOSSE. j'ai fait la BOSSE de LANGUE ! Il y aura 10 BOSSES de LANGUE (et ces mots trop). BOSSE BOSSE BOSSE BOSSE BOSSE BOSSE BOSSE BOSSE BOSSE BOSSE BOSSE BOSSE
FRENCH

Warum seien Sie bildet einen Stoß? Durch das Thema von Leviathan, das wir müssen have/must STOSS-STOSS-STOSS ahem STOSSEN... uns continioue lassen, ist es hart, 50 Seiten reinen STOSS zu haben und härter, 100 Seiten reines STOSS sooooo zu haben. ich bildete SPRACHENSTOSS! Es gibt 10 SPRACHENSTÖSSE (und diese Wörter auch). STOSS STOSS STOSS STOSS STOSS STOSS STOSS STOSS STOSS STOSS STOSS STOSS

GERMAN

Γιατί είναι κάνει μια πρόσκρουση; Από το θέμα leviathan, έχουμε/πρέπει να πρέπει ΝΑ ΧΤΥΠΗΣΟΥΜΕ την ΠΡΟΣΚΡΟΥΣΗ ΠΡΟΣΚΡΟΥΣΕΩΝ ΠΡΟΣΚΡΟΥΣΕΩΝ ahem... continioue, είναι δύσκολο να υπάρξουν 50 σελίδες της καθαρής ΠΡΟΣΚΡΟΥΣΗΣ και σκληρότερος να έχει 100 σελίδες του καθαρού sooooo ΠΡΟΣΚΡΟΥΣΕΩΝ. έκανα τη ΓΛΩΣΣΙΚΗ ΠΡΟΣΚΡΟΥΣΗ! Θα υπάρξουν 10 ΓΛΩΣΣΙΚΕΣ ΠΡΟΣΚΡΟΥΣΕΙΣ (και αυτές οι λέξεις επίσης). ΠΡΟΣΚΡΟΥΣΗ ΠΡΟΣΚΡΟΥΣΗ ΠΡΟΣΚΡΟΥΣΗ ΠΡΟΣΚΡΟΥΣΗ ΠΡΟΣΚΡΟΥΣΗ ΠΡΟΣΚΡΟΥΣΗ ΠΡΟΣΚΡΟΥΣΗ ΠΡΟΣΚΡΟΥΣΗ ΠΡΟΣΚΡΟΥΣΗ ΠΡΟΣΚΡΟΥΣΗ ΠΡΟΣΚΡΟΥΣΗ ΠΡΟΣΚΡΟΥΣΗ

GREEK

Perchè sia sta facendo un urto? Dal soggetto di Leviathan, che have/must devono URTARE il ahem dell'URTO dell'URTO dell'URTO... li lasciamo continioue, sarà duro avere 50 pagine dell'URTO puro e più duro avere 100 pagine del sooooo puro dell'URTO. ho fatto l'URTO di LINGUA! Ci saranno 10 URTI di LINGUA (e queste parole ugualmente). URTO URTO URTO URTO URTO URTO URTO URTO URTO URTO URTO URTO

ITALIAN

Por que seja esteja fazendo uma colisão? Pelo tópico de Leviathan, que nós have/must têm que COLIDIR o ahem da COLISÃO da COLISÃO da COLISÃO... nos deixamos continioue, será duro ter 50 páginas da COLISÃO pura e mais duro ter 100 páginas do sooooo puro da COLISÃO. eu fiz a COLISÃO da LÍNGUA! Haverá 10 COLISÕES da LÍNGUA (e estas palavras demasiado). COLISÃO COLISÃO COLISÃO COLISÃO COLISÃO COLISÃO COLISÃO COLISÃO COLISÃO COLISÃO COLISÃO COLISÃO

PORTUGEESE



 
Title: The Bumpy Thread
Post by: Brazilian Fan on October 20, 2006, 12:59:26 PM
Quote
Por que seja esteja fazendo uma colisão? Pelo tópico de Leviathan, que nós have/must têm que COLIDIR o ahem da COLISÃO da COLISÃO da COLISÃO... nos deixamos continioue, será duro ter 50 páginas da COLISÃO pura e mais duro ter 100 páginas do sooooo puro da COLISÃO. eu fiz a COLISÃO da LÍNGUA! Haverá 10 COLISÕES da LÍNGUA (e estas palavras demasiado). COLISÃO COLISÃO COLISÃO COLISÃO COLISÃO COLISÃO COLISÃO COLISÃO COLISÃO COLISÃO COLISÃO COLISÃO

LOL. that translator you used is the worse I've ever seen. I didn't understand a thing.

post the english version you BUMP
Title: The Bumpy Thread
Post by: CK9 on October 22, 2006, 11:34:34 PM
bump that
Title: The Bumpy Thread
Post by: Chandler on October 23, 2006, 07:22:10 PM
I bumpond that!
Title: The Bumpy Thread
Post by: CK9 on October 25, 2006, 07:29:36 PM
well then bump you!
Title: The Bumpy Thread
Post by: plymoth45 on October 29, 2006, 01:36:10 AM
the bump never did pick back up, eh?
Title: The Bumpy Thread
Post by: TRIX Rabbit on October 30, 2006, 05:56:34 PM
Bumps are so awesome, they're awesome. BUMP  
Title: The Bumpy Thread
Post by: Chandler on October 30, 2006, 07:27:13 PM
Bump? BUMP you all!!!

Bumpahahahahahahahahahahahahahahahahahahahahahahahahahahaha
Title: The Bumpy Thread
Post by: Eddy-B on October 31, 2006, 06:18:14 AM
BOMB[size=8]
.. i mean BUMP[/size]
Title: The Bumpy Thread
Post by: plymoth45 on October 31, 2006, 08:00:17 AM
Leave it to me to ressurrect the bumps!
Title: The Bumpy Thread
Post by: lordly_dragon on October 31, 2006, 09:23:39 AM
aww bump another sucessfull OP!
Title: The Bumpy Thread
Post by: Sl0vi on November 01, 2006, 06:32:12 AM
bump
Title: The Bumpy Thread
Post by: lordly_dragon on November 01, 2006, 11:36:00 AM
blump bump
Title: The Bumpy Thread
Post by: Chandler on November 01, 2006, 07:21:18 PM
KABUMP
Title: The Bumpy Thread
Post by: CK9 on November 05, 2006, 01:41:24 AM
half-hearted bump
Title: The Bumpy Thread
Post by: Sl0vi on November 09, 2006, 10:56:32 AM
full-hearted bump
Title: The Bumpy Thread
Post by: Brazilian Fan on November 09, 2006, 02:09:21 PM
Quote
B U M P
U * * M
M * * U
P M U B

PMUB<-->BUMP

   P
   M
   U
   B
   ||
   ||
   B
   U
   M
   P

BUMP RULES
Title: The Bumpy Thread
Post by: Chandler on November 09, 2006, 07:19:40 PM
..... What the BuMp?!!!
Title: The Bumpy Thread
Post by: CK9 on November 10, 2006, 08:31:21 AM
Quote
Quote
B U M P
U * * M
M * * U
P M U B
(bump)^2 or square bumping?
Title: The Bumpy Thread
Post by: Sl0vi on November 10, 2006, 09:59:06 AM
BUMP!
Title: The Bumpy Thread
Post by: BlackBox on November 10, 2006, 12:30:21 PM
BUMPY CARS
Title: The Bumpy Thread
Post by: Sl0vi on November 17, 2006, 10:59:15 AM
gotta keep bumpin!
Title: The Bumpy Thread
Post by: Eddy-B on November 17, 2006, 11:32:07 AM
B U M P - P M U B
Title: The Bumpy Thread
Post by: lordly_dragon on November 17, 2006, 03:36:50 PM
Call now 1-800-bump to get a free bump by the bump master lordly ''bump'' dragon
Title: The Bumpy Thread
Post by: Sl0vi on November 18, 2006, 11:59:10 AM
ZOMG IT*S TEH BUMP!!!11123
Title: The Bumpy Thread
Post by: Chandler on November 19, 2006, 07:23:23 PM
I like to bump it bump it, I like to bump it bump it!

I like to bump it bump it, I like to bump it bump it!

I like to bump it bump it, I like to bump it bump it!
Title: The Bumpy Thread
Post by: lordly_dragon on November 21, 2006, 02:15:26 PM
BABEDI BADA BUMP BI DOU
Title: The Bumpy Thread
Post by: Sl0vi on November 27, 2006, 04:36:56 PM
bump
Title: The Bumpy Thread
Post by: lordly_dragon on December 05, 2006, 03:03:07 PM
buuuuuuuuuuuuumping
Title: The Bumpy Thread
Post by: siqueule on December 07, 2006, 04:52:46 AM
give me a B!
.
.
.
give me a U!
.
.
.
give me a M!
.
.
.
give me a P!

B-U-M-P
(http://www.jeuxvideo.com/smileys/62.gif)
Title: The Bumpy Thread
Post by: dm-horus on December 07, 2006, 06:55:08 AM
booty bump cheeks
booty bump cheeks
booty bump booty bump booty bump cheeks
Title: The Bumpy Thread
Post by: lordly_dragon on December 07, 2006, 08:08:47 AM
READY!

SET!

BUMP BUMP BUMP!!!!  
Title: The Bumpy Thread
Post by: Sl0vi on December 09, 2006, 09:34:23 AM
bump! :D
Title: The Bumpy Thread
Post by: dm-horus on December 09, 2006, 04:11:18 PM
(http://upload.wikimedia.org/wikipedia/en/0/07/Mr._Bump.jpg)
Title: The Bumpy Thread
Post by: Hooman on December 10, 2006, 04:57:53 PM
OMG! That is bumping kick ass! I haven't seen those books in ages. I used to love them.  :)  
Title: The Bumpy Thread
Post by: Mez on December 11, 2006, 03:49:30 AM
bump
Title: The Bumpy Thread
Post by: gpgarrettboast on December 11, 2006, 04:25:47 AM
BUMP!
OHZC!
38ddfe7168891723e977a47876971baf!
QlVNUA==!
01000010 01010101 01001101 01010000!
42 55 4d 50!
CRqZNu59Z5Ros!
8241!
BUMP!
 
Title: The Bumpy Thread
Post by: Chandler on December 12, 2006, 07:22:11 PM
Bump! I'm BACK!
Title: The Bumpy Thread
Post by: lordly_dragon on December 16, 2006, 07:19:18 PM
BUMPPPPPPPP
Title: The Bumpy Thread
Post by: dm-horus on December 16, 2006, 11:14:31 PM
62756D706974792062756D702062756D70DA62756D706974792062756D702062756D70
Title: The Bumpy Thread
Post by: Savant 231-A on December 21, 2006, 01:29:15 PM
NO BUMP you are still young! Stay alive!

So everyone let us have a real big BUMP
Title: The Bumpy Thread
Post by: Mez on December 22, 2006, 09:15:43 AM
bump
Title: The Bumpy Thread
Post by: Leviathan on December 22, 2006, 09:19:25 AM
xmas bump!
Title: The Bumpy Thread
Post by: Savant 231-A on December 28, 2006, 11:29:30 AM
New Year BUMP
 Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump Bump!
Enough bumps?
Title: The Bumpy Thread
Post by: Sl0vi on December 28, 2006, 04:59:28 PM
bump no!
Title: The Bumpy Thread
Post by: Savant 231-A on February 19, 2007, 06:15:25 AM
BUUUUUMPPP!!!
Holy BUMP!
We all forgot on the BUMP!!!

"Revive the Bump, or suffer my hard-drive on your head"
Title: The Bumpy Thread
Post by: Hooman on February 19, 2007, 02:03:11 PM
Umm... Happy Lunar New Year bump?
 
Title: The Bumpy Thread
Post by: Chandler on February 19, 2007, 07:07:05 PM
Ahh... so that would explain the Lunar Festival on WoW the other day.....

BUMP!!

HAPPY LUNAR NEW YEAR!!!!!!!!!!!!!!!!!!!
Title: The Bumpy Thread
Post by: dm-horus on March 03, 2007, 09:52:48 AM
Happy getting close to Green Beer Day BUMP!!!!

B U M P ! ! !
Title: The Bumpy Thread
Post by: Savant 231-A on March 03, 2007, 10:47:20 AM
GIVE ME A   B
GIVE ME A   U
GIVE ME A   M
GIVE ME A   P

GIVE ME A   BUMP!

(plese post just 2 more posts so that bumpy thread would have 1000 posts!)
Title: The Bumpy Thread
Post by: Chandler on March 04, 2007, 07:24:01 PM
Here comes bump # 999.... let's see who'll get # 1000
Title: The Bumpy Thread
Post by: Hooman on March 04, 2007, 10:13:56 PM
I was so bumping tempted to close the topic yesterday, leaving a single bump to bring it up to #999. Then laugh at all the time that's been wasted on this pointless thread.

Ok, so I guess this makes it #1000. You got there afterall.
 
Title: The Bumpy Thread
Post by: Savant 231-A on March 05, 2007, 05:16:38 AM
HUUUURRRAAAYYYY!

BUMP-TASTIC!
Title: The Bumpy Thread
Post by: Mez on March 05, 2007, 11:28:21 AM
bump
Title: The Bumpy Thread
Post by: White Claw on March 05, 2007, 08:36:19 PM
Bumpity upm upm...
Title: The Bumpy Thread
Post by: Savant 231-A on April 15, 2007, 11:41:39 AM
BRRRMMMPPP...
Excuse me... that was a error
AHEM...
BBBBUUUUMMMMPPPPP!!!
Title: The Bumpy Thread
Post by: Sl0vi on April 15, 2007, 04:25:36 PM
O_O

BUMP!
Title: The Bumpy Thread
Post by: dm-horus on April 15, 2007, 09:39:09 PM
This bump has been BUMPED too many times. Time to BUMP IT IN THE EAR!
Title: The Bumpy Thread
Post by: Stormy on April 16, 2007, 05:24:23 PM
poof....

bump.
Title: The Bumpy Thread
Post by: Sl0vi on May 15, 2007, 09:18:58 AM
don't forget to bump! :D
Title: The Bumpy Thread
Post by: ARES on June 25, 2007, 10:53:30 AM
BUMP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!




 :CK9's:  :CK9's:  :CK9's:  :CK9's:  :CK9's:  :CK9's:  :CK9's:  :bump:  :bump:  :bump:  :bump:  :bump:  :bump:  :bump:  :anibump:   :anibump:  :anibump:  
Title: The Bumpy Thread
Post by: Eddy-B on July 03, 2007, 01:29:05 PM
Rulez are simple savant...: you need to BUMP !

:P
Title: The Bumpy Thread
Post by: Freeza-CII on July 03, 2007, 02:30:29 PM
Bump
Title: The Bumpy Thread
Post by: Brazilian Fan on July 03, 2007, 02:59:38 PM
V o b e l u r d m y p

For those bumping lamers: Very old bump  :P  
Title: The Bumpy Thread
Post by: Betaray on July 03, 2007, 04:57:37 PM
vintage bump
Title: The Bumpy Thread
Post by: Sl0vi on July 03, 2007, 04:58:56 PM
wow, people started bumping again! :D
Title: The Bumpy Thread
Post by: ARES on July 03, 2007, 07:57:02 PM
Rawr... Bleh





BUMP

Someone bump again, i need to post some ascii art
Title: The Bumpy Thread
Post by: Savant 231-A on July 04, 2007, 01:29:39 AM
Quote
Rulez are simple savant...: you need to BUMP !

:P
Well than.
BUMP
Title: The Bumpy Thread
Post by: Sl0vi on July 04, 2007, 04:10:39 AM
bump.
Title: The Bumpy Thread
Post by: Eddy-B on July 04, 2007, 09:10:18 AM
Bumpalicious, Savant !
Title: The Bumpy Thread
Post by: Brazilian Fan on July 04, 2007, 10:29:52 AM
Cvnq
Bump
Title: The Bumpy Thread
Post by: Savant 231-A on July 04, 2007, 11:21:35 AM
Quote
Bumpalicious, Savant !
Yay! *bumps all around the place* - bump
Title: The Bumpy Thread
Post by: Betaray on July 04, 2007, 11:42:44 AM
bump till you drop
Title: The Bumpy Thread
Post by: Brazilian Fan on July 04, 2007, 02:45:53 PM
A cyphered bumping message

Atlo
Title: The Bumpy Thread
Post by: Savant 231-A on July 05, 2007, 12:13:31 PM
Hey, thats not a bump!
*Bumps the "atlo"*
Title: The Bumpy Thread
Post by: Sl0vi on July 05, 2007, 07:06:38 PM
edit - bump
Title: The Bumpy Thread
Post by: Savant 231-A on September 03, 2007, 09:09:54 AM
(http://i176.photobucket.com/albums/w172/Savant-231-A/BUMP.jpg)
Title: The Bumpy Thread
Post by: Freeza-CII on September 03, 2007, 10:50:21 AM
BUMP OF IMPENDING DOOM 1
Title: The Bumpy Thread
Post by: Quantum on September 03, 2007, 04:25:57 PM
What is this :huh:



Bump!
(You've been forced to bump)
 
Title: The Bumpy Thread
Post by: Savant 231-A on September 03, 2007, 11:36:50 PM
Quote
What is this :huh:
Mine is a comet that hits Earth, and instead of a "BRAAAANG" or "SBRAAAAANG" or just "BOOOOM" it makes "Bump."


And Freeza's... Freeza?
Title: The Bumpy Thread
Post by: Leviathan on September 09, 2007, 06:34:49 AM
bump.
Title: The Bumpy Thread
Post by: CK9 on September 09, 2007, 01:02:50 PM
wow, this bumping thing is still around?
Title: The Bumpy Thread
Post by: Sl0vi on September 09, 2007, 05:34:10 PM
bumping yes
Title: The Bumpy Thread
Post by: White Claw on September 09, 2007, 07:16:21 PM
Quote
What is this 
Someone needs to tell Quantum that posts in this thread need to include "Bump". Oh wait, I just did...  :o  (oooo, topper)
Title: The Bumpy Thread
Post by: Savant 231-A on September 09, 2007, 10:18:02 PM
Bump
Title: The Bumpy Thread
Post by: Hooman on September 10, 2007, 02:41:21 PM
Wow, that looks like bumping ellipses.
 
Title: The Bumpy Thread
Post by: CK9 on September 10, 2007, 03:04:09 PM
my bumping permanent retainer made a noise, and now I feel extra pressure on my teeth :(
Title: The Bumpy Thread
Post by: Savant 231-A on September 11, 2007, 10:25:28 AM
BUMP
Title: The Bumpy Thread
Post by: Hidiot on September 12, 2007, 04:52:03 AM
[size=8]bump[/size],bump or  :anibump:  
Title: The Bumpy Thread
Post by: Savant 231-A on October 06, 2007, 07:34:43 PM
(http://i176.photobucket.com/albums/w172/Savant-231-A/ist2_2304394_baby_girl.jpg)

 :)  
Title: The Bumpy Thread
Post by: Sl0vi on October 19, 2007, 12:08:12 AM
bump :o
Title: The Bumpy Thread
Post by: Hidiot on October 19, 2007, 08:30:23 AM
But what is the Ultimate Meaning for this...  big Problems no exist...


Sublime  :whistle:
Title: The Bumpy Thread
Post by: Savant 231-A on October 19, 2007, 06:03:55 PM
ah, isn't this easier to just to say BUMP?

Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
Bump
BUMP!
Title: The Bumpy Thread
Post by: Sl0vi on October 22, 2007, 01:38:03 PM
agreed. bump
Title: The Bumpy Thread
Post by: zhukant on October 23, 2007, 05:58:24 AM
bumptiousness. It appears to be a real word o.O  
Title: The Bumpy Thread
Post by: zeritou on October 24, 2007, 05:42:25 PM
so, im back, mainly b/c im bored, prolly gonna dissappear again after im done ridding myself of all these pennies

bump
Title: The Bumpy Thread
Post by: Sl0vi on March 01, 2008, 09:42:14 PM
bump revival!
Title: The Bumpy Thread
Post by: DarekStar on March 03, 2008, 04:43:04 AM
Savan Siries computer Bumptivate beggining command level bump

for your Bump only.


Historical overbump the bunp is dead.

As the bumptroid fragments landed the last few bumps departed the bump

seeking a new bump amongs the bumps
................................................
Bump after unsutable Bump was rejected


Their Bumps low situation Bump


a marjinaly sutible bump was found.


they called the bump New Bump.
Title: The Bumpy Thread
Post by: Sl0vi on March 03, 2008, 06:19:50 AM
You have failed! Our bump is doomed!
Title: The Bumpy Thread
Post by: DarekStar on March 03, 2008, 06:40:28 AM
Cut the red wire!!!!




bump
Title: The Bumpy Thread
Post by: Savant 231-A on March 04, 2008, 01:19:32 AM
B

(now, someone post the next letter)

Edit by Mez: You Have to post the entire word "bump" in each post!

Even if its in small letters so u can do a split post big BUMP!
Title: The Bumpy Thread
Post by: Mez on March 04, 2008, 07:34:17 AM
U

[size=8]bump[/size]
Title: The Bumpy Thread
Post by: Hidiot on March 04, 2008, 07:41:07 AM
M


 :anibump:
Title: The Bumpy Thread
Post by: DarekStar on March 04, 2008, 02:51:26 PM
P


bump


dunno how to make big :P
Title: The Bumpy Thread
Post by: Savant 231-A on March 21, 2008, 02:29:36 AM
This topic got BUMPED
Title: The Bumpy Thread
Post by: Hidiot on March 22, 2008, 04:12:25 AM
Are you bumpidy sure?
Title: The Bumpy Thread
Post by: Mez on March 22, 2008, 06:05:14 AM
I bumpidity am
Title: The Bumpy Thread
Post by: Savant 231-A on March 22, 2008, 07:59:35 AM
Bµmp
Title: The Bumpy Thread
Post by: Freeza-CII on March 22, 2008, 09:00:25 AM
damn bumplings
Title: The Bumpy Thread
Post by: Savant 231-A on March 23, 2008, 01:26:23 AM
/me bumps Freeza out of here
Title: The Bumpy Thread
Post by: Betaray on March 23, 2008, 12:52:45 PM
your just a tenderbump
Title: The Bumpy Thread
Post by: Freeza-CII on March 23, 2008, 03:09:29 PM
Ill bump you bump off you bump hole
Title: The Bumpy Thread
Post by: Betaray on March 23, 2008, 08:24:29 PM
kiss my shiny metal bump!!!!!
Title: The Bumpy Thread
Post by: Hidiot on March 24, 2008, 01:45:09 AM
stop bumping eachother!
Title: The Bumpy Thread
Post by: zyphera on June 02, 2008, 12:32:18 PM
[dohtml]
<span style=z-index:0;position:relative;left:0;top:0><span style=z-index:0;position:absolute;left:0;top:0><span style=position:absolute;z-index:1><marquee behavior=alternate direction=left width=320 height=240 scrollamount=20><marquee behavior=alternate direction=up width=120 height=320 scrollamount=1><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:2><marquee behavior=alternate direction=left width=320 height=240 scrollamount=19><marquee behavior=alternate direction=up width=120 height=320 scrollamount=2><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:3><marquee behavior=alternate direction=left width=320 height=240 scrollamount=18><marquee behavior=alternate direction=up width=120 height=320 scrollamount=3><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:4><marquee behavior=alternate direction=left width=320 height=240 scrollamount=17><marquee behavior=alternate direction=up width=120 height=320 scrollamount=4><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:5><marquee behavior=alternate direction=left width=320 height=240 scrollamount=16><marquee behavior=alternate direction=up width=120 height=320 scrollamount=5><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:6><marquee behavior=alternate direction=left width=320 height=240 scrollamount=15><marquee behavior=alternate direction=up width=120 height=320 scrollamount=6><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:7><marquee behavior=alternate direction=left width=320 height=240 scrollamount=14><marquee behavior=alternate direction=up width=120 height=320 scrollamount=7><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:8><marquee behavior=alternate direction=left width=320 height=240 scrollamount=13><marquee behavior=alternate direction=up width=120 height=320 scrollamount=8><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:9><marquee behavior=alternate direction=left width=320 height=240 scrollamount=12><marquee behavior=alternate direction=up width=120 height=320 scrollamount=9><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:10><marquee behavior=alternate direction=left width=320 height=240 scrollamount=11><marquee behavior=alternate direction=up width=120 height=320 scrollamount=10><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:11><marquee behavior=alternate direction=left width=320 height=240 scrollamount=10><marquee behavior=alternate direction=up width=120 height=320 scrollamount=11><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:12><marquee behavior=alternate direction=left width=320 height=240 scrollamount=9><marquee behavior=alternate direction=up width=120 height=320 scrollamount=12><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:13><marquee behavior=alternate direction=left width=320 height=240 scrollamount=8><marquee behavior=alternate direction=up width=120 height=320 scrollamount=13><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:14><marquee behavior=alternate direction=left width=320 height=240 scrollamount=7><marquee behavior=alternate direction=up width=120 height=320 scrollamount=14><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:15><marquee behavior=alternate direction=left width=320 height=240 scrollamount=6><marquee behavior=alternate direction=up width=120 height=320 scrollamount=15><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:16><marquee behavior=alternate direction=left width=320 height=240 scrollamount=5><marquee behavior=alternate direction=up width=120 height=320 scrollamount=16><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:17><marquee behavior=alternate direction=left width=320 height=240 scrollamount=4><marquee behavior=alternate direction=up width=120 height=320 scrollamount=17><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:18><marquee behavior=alternate direction=left width=320 height=240 scrollamount=3><marquee behavior=alternate direction=up width=120 height=320 scrollamount=18><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:19><marquee behavior=alternate direction=left width=320 height=240 scrollamount=2><marquee behavior=alternate direction=up width=120 height=320 scrollamount=19><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span><span style=position:absolute;z-index:20><marquee behavior=alternate direction=left width=320 height=240 scrollamount=1><marquee behavior=alternate direction=up width=120 height=320 scrollamount=20><table summary=1 border=0 bgcolor=#112233><tr><td><font color=gold>Bump</font></td></tr></table></marquee></marquee></span></span></span>
[/dohtml]
Title: The Bumpy Thread
Post by: DarekStar on June 03, 2008, 03:48:06 AM
Bump


http://www.youtube.com/v/IBrFTDGjSVw&hl=en (http://www.youtube.com/v/IBrFTDGjSVw&hl=en)


cant tell if hes saying bump or bonk eather way its cool
Title: The Bumpy Thread
Post by: Savant 231-A on June 03, 2008, 05:19:00 AM
simple bump
Title: The Bumpy Thread
Post by: Moley on January 24, 2009, 08:15:51 AM
can i play,  :anibump:
PS: love animated smiles! (thumbsup)  
Title: The Bumpy Thread
Post by: Leviathan on January 24, 2009, 02:24:12 PM
bump
Title: The Bumpy Thread
Post by: Mez on January 24, 2009, 06:24:22 PM
bump
Title: The Bumpy Thread
Post by: fighter on January 27, 2009, 08:21:06 AM
BumpBumpBump
Title: The Bumpy Thread
Post by: Derekristow on January 30, 2009, 09:52:06 PM
bumpercar
Title: The Bumpy Thread
Post by: fighter on February 01, 2009, 01:17:28 PM
The bumps shall continue until morale improves.
Title: The Bumpy Thread
Post by: Moley on July 28, 2009, 04:09:53 PM
or until we install a speed bump
Title: The Bumpy Thread
Post by: WalkmanSilver on July 29, 2009, 02:08:29 PM
Lots of bump games that could be made

Left 4 Bump
Call of Bumpy 4 Modern Bumpfare
Outpost 2 Divided Bump
Silent Bump

 
Title: The Bumpy Thread
Post by: instigator on August 31, 2009, 10:01:46 AM
1st for august bump!

edit: and last apparently.... if nobody else posts before the day is over lol
Title: The Bumpy Thread
Post by: Hidiot on August 31, 2009, 10:02:48 AM
I bump that.
Title: The Bumpy Thread
Post by: Moley on August 31, 2009, 04:25:42 PM
i second that bumption
Title: The Bumpy Thread
Post by: Mez on January 20, 2010, 09:55:28 AM
Bump
Title: The Bumpy Thread
Post by: CK9 on January 20, 2010, 12:36:22 PM
b..u..m..p..!
Title: The Bumpy Thread
Post by: Betaray on January 21, 2010, 10:09:59 PM
B to the

M to the

U to the

P!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Title: The Bumpy Thread
Post by: CK9 on January 21, 2010, 10:18:11 PM
what is bmup?

:P

bump
Title: The Bumpy Thread
Post by: Arklon on January 22, 2010, 07:18:39 AM
Warning: bump eruption detected.
Title: The Bumpy Thread
Post by: CK9 on January 22, 2010, 08:22:31 AM
You have bumped, our colony is doomed!
Title: The Bumpy Thread
Post by: Arklon on January 22, 2010, 01:05:37 PM
You have done well, our colony is bumping.
Title: The Bumpy Thread
Post by: Mez on January 22, 2010, 03:05:01 PM
Commander, your colony is bumping
Title: The Bumpy Thread
Post by: CK9 on January 22, 2010, 05:44:30 PM
better bumping than grinding
Title: The Bumpy Thread
Post by: Mez on January 24, 2010, 07:46:22 AM
Bump factory completed
Title: The Bumpy Thread
Post by: Spikerocks101 on January 24, 2010, 08:27:05 AM
Bumb ready.  
Title: The Bumpy Thread
Post by: Mez on January 24, 2010, 10:04:39 AM
bump disabled
Title: The Bumpy Thread
Post by: Simpsonboy77 on January 24, 2010, 06:42:49 PM
Warning: Incoming bump detected.
Title: The Bumpy Thread
Post by: CK9 on January 24, 2010, 08:48:28 PM
bump-er cars
Title: The Bumpy Thread
Post by: Betaray on January 24, 2010, 09:31:13 PM
Old school

BetaBump
Title: The Bumpy Thread
Post by: Mez on January 25, 2010, 04:45:44 AM
bump?
Title: The Bumpy Thread
Post by: CK9 on January 25, 2010, 08:24:13 AM
Your tastebuds can't bump flavor of that magnitude!
Title: The Bumpy Thread
Post by: Mez on January 26, 2010, 09:40:13 AM
flavourless bump
Title: The Bumpy Thread
Post by: CK9 on January 26, 2010, 02:19:34 PM
that's the bumpiest way to eat your bumps without cringing :P
Title: The Bumpy Thread
Post by: Mez on January 27, 2010, 06:41:22 AM
You eat bumps for breakfast? You cruel being, they have feelings you know!
Title: The Bumpy Thread
Post by: CK9 on January 27, 2010, 08:20:33 AM
yea, I know, they feel rather bumpy to te touch :P
Title: The Bumpy Thread
Post by: Mez on January 28, 2010, 03:54:57 PM
but are they bumplicious?
Title: The Bumpy Thread
Post by: CK9 on January 28, 2010, 05:07:29 PM
to that I reply: bump
Title: The Bumpy Thread
Post by: Mez on January 29, 2010, 10:46:09 AM
bump
Title: The Bumpy Thread
Post by: CK9 on January 29, 2010, 10:59:08 AM
bump you out of orbit
Title: The Bumpy Thread
Post by: Sl0vi on March 04, 2010, 07:46:13 PM
been a long time since I last bumped
Title: The Bumpy Thread
Post by: Kayedon on March 04, 2010, 09:39:46 PM
Caution: Bump watch initiated.
Title: The Bumpy Thread
Post by: Lord Of Pain on March 05, 2010, 04:39:29 AM
*sings the x-mas carol*

BBRRRRRRUPM-UMP-UMP-UMP...IN MY DRUMS...
Title: The Bumpy Thread
Post by: CK9 on March 05, 2010, 08:19:45 AM
*bumps each of you on the head*
Title: The Bumpy Thread
Post by: Freeza-CII on June 04, 2010, 01:14:24 PM
bump
Title: The Bumpy Thread
Post by: Betaray on June 04, 2010, 05:14:07 PM
bump?
Title: The Bumpy Thread
Post by: Mez on June 05, 2010, 09:43:50 AM
bump :)
Title: The Bumpy Thread
Post by: CK9 on June 06, 2010, 08:59:49 PM
*bump*
Title: The Bumpy Thread
Post by: Sl0vi on June 16, 2010, 05:24:28 PM
bump
Title: The Bumpy Thread
Post by: Betaray on June 16, 2010, 08:13:19 PM
shameless bump
Title: The Bumpy Thread
Post by: CK9 on June 16, 2010, 08:30:46 PM
the infamous beta bump 2.0?
Title: The Bumpy Thread
Post by: Spikerocks101 on June 17, 2010, 12:07:21 PM
In the words of the Black Eyed Peas: My Bumbs, My Bumbs, My Lovely Lady Bumbs? XD
Title: The Bumpy Thread
Post by: Sirbomber on June 17, 2010, 01:20:58 PM
It's bump you fool, not "bumb".  And BLARARARARUGHGH.
Title: The Bumpy Thread
Post by: CK9 on June 17, 2010, 05:00:11 PM
bump
Title: The Bumpy Thread
Post by: evecolonycamander on June 17, 2010, 06:19:48 PM
this pointless BUMPing... somehow it amuses me
Title: The Bumpy Thread
Post by: Betaray on June 17, 2010, 11:40:17 PM
Over 5 years ago I wrote my first bump wondering how long it would take to get to 100 pages.

5 years later and we aren't even on page 50 yet.

STEP IT UP GUYS!!! BUMP LIKE YOU HAVE NEVER BUMPED BEFORE!!!!!
Title: The Bumpy Thread
Post by: CK9 on June 18, 2010, 12:26:28 AM
it would help if you bumped more too!
Title: The Bumpy Thread
Post by: Hidiot on June 18, 2010, 12:29:54 AM
Bumping is fun only for so long.
Title: The Bumpy Thread
Post by: Sirbomber on June 18, 2010, 04:39:59 AM
Wait, this is supposed to be fun?!

Bumpz
Title: The Bumpy Thread
Post by: Hidiot on June 18, 2010, 05:32:46 AM
Quote
Wait, this is supposed to be fun?!

Bumpz
Why play a forum game called "The Bumpy thread" if not for fun?
Title: The Bumpy Thread
Post by: Sirbomber on June 18, 2010, 05:44:36 AM
Games don't have to be fun.  World of Warcraft, for example.

Again, tiny bump.
Title: The Bumpy Thread
Post by: Hidiot on June 18, 2010, 06:01:19 AM
Then a new term should be invented, because a game represents "A pursuit or activity [...] performed [...], for the purpose of entertainment."

I challenge the size of your bumps
Title: The Bumpy Thread
Post by: evecolonycamander on June 18, 2010, 07:27:49 AM
be bop...
be bumped
Title: The Bumpy Thread
Post by: CK9 on June 18, 2010, 10:40:54 AM
bump bump buuuuuuuuuuuuuuuuuuuuuump
Title: The Bumpy Thread
Post by: Spikerocks101 on June 18, 2010, 11:04:42 AM
BUMP IT! TWIST IT! TURN IT! BUMP IT!
Title: The Bumpy Thread
Post by: CK9 on June 18, 2010, 11:42:55 AM
bump the world
Title: The Bumpy Thread
Post by: evecolonycamander on June 18, 2010, 12:19:19 PM
and watch as it bumps down drury lane
Title: The Bumpy Thread
Post by: Moley on June 18, 2010, 07:08:46 PM
a bumpy land is naught but a bump on the bumpy world
Title: The Bumpy Thread
Post by: Betaray on June 18, 2010, 08:02:10 PM
belated bump
Title: The Bumpy Thread
Post by: evecolonycamander on June 18, 2010, 08:14:28 PM
what rhymes with bump
 
Title: The Bumpy Thread
Post by: Spikerocks101 on June 18, 2010, 10:46:46 PM
Ask not what your bump can do for you, but what you can do for your bump.
Title: The Bumpy Thread
Post by: CK9 on June 18, 2010, 11:19:18 PM
I though we lost some bumps for a moment there until I re0checked the previous page
Title: The Bumpy Thread
Post by: evecolonycamander on June 19, 2010, 03:03:44 AM
oh the evil "delete your bump" button
Title: The Bumpy Thread
Post by: Betaray on June 23, 2010, 10:53:49 PM
facebump

(ouch)
Title: The Bumpy Thread
Post by: Spikerocks101 on June 24, 2010, 02:20:56 AM
John: Yo, Freddy, what happened to Marc?
Fred: He got bumped by the bumpsters.
Title: The Bumpy Thread
Post by: evecolonycamander on June 24, 2010, 08:38:55 AM
THE BUMP GUN
bu bu bum bu bum bum BUMP
Title: The Bumpy Thread
Post by: Betaray on June 25, 2010, 11:55:43 PM
Because he makes a twirl in life, my box is broken, help me blue elephant!! Isn't lettuce brave? I like electrons hello.

word salad bump
Title: The Bumpy Thread
Post by: Hidiot on June 26, 2010, 12:19:13 AM
No more bump molesting, ok?
Title: The Bumpy Thread
Post by: CK9 on June 26, 2010, 08:07:44 PM
you feel rather bumpy
Title: The Bumpy Thread
Post by: evecolonycamander on June 26, 2010, 08:09:22 PM
yucky bump
Title: The Bumpy Thread
Post by: Betaray on June 26, 2010, 11:37:57 PM
It is dark, you fear you might get eaten by a BUMP!!!
Title: The Bumpy Thread
Post by: Freeza-CII on June 27, 2010, 06:33:59 AM
Failing jib arm flailing falling up side of beef. Purple Dawn when watery where as ducks.

counter word salad bump
Title: The Bumpy Thread
Post by: evecolonycamander on June 27, 2010, 08:51:43 AM
corn on the... bump?!?!?!
 
Title: The Bumpy Thread
Post by: Lord Of Pain on June 27, 2010, 09:46:30 AM
we will we will BUMP you!!!!
Title: The Bumpy Thread
Post by: evecolonycamander on June 27, 2010, 11:48:00 AM
lop got bumped off
Title: The Bumpy Thread
Post by: plymoth45 on June 27, 2010, 06:26:05 PM
Ancient bump
Title: The Bumpy Thread
Post by: Spikerocks101 on June 28, 2010, 09:24:36 AM
My Bump is too big. My Bump is tooooo big.

I am a Bumpana.
Title: The Bumpy Thread
Post by: evecolonycamander on June 28, 2010, 10:55:10 AM
your mom may have said "Stop being a bump on a log and get your self a job"
Title: The Bumpy Thread
Post by: Spikerocks101 on June 28, 2010, 12:07:55 PM
Bumptoise, use Hyper Bumb.
Its super effective.
Charizard bumbed.
Title: The Bumpy Thread
Post by: evecolonycamander on June 28, 2010, 05:18:40 PM
POKEMON BUMP!?!?!?!
no do it right
nuclear bump
..___________..
/.......................\
|........................|
---------------------
.........|.....|..........
.........|.....|..........
.......[[||||||]].......
......../.......\.........
....../...........\.......
BOOOOOOOOOOM
Title: The Bumpy Thread
Post by: CK9 on June 29, 2010, 09:00:44 AM
bump
Title: The Bumpy Thread
Post by: evecolonycamander on June 29, 2010, 09:15:55 AM
what... no smart Alic antics? come on and get creative with your bumps
Title: The Bumpy Thread
Post by: CK9 on June 29, 2010, 10:37:09 AM
Don't argue with the staff!  You will find a rather bumpy surprise :P
Title: The Bumpy Thread
Post by: evecolonycamander on June 29, 2010, 12:00:05 PM
now who said the last bump was argumentative.
nah i say it was creative.
Title: The Bumpy Thread
Post by: Freeza-CII on June 29, 2010, 12:00:41 PM
my bump brings all the guys to the yard at night its better then yours damn right its better then yours damn right i could show you but i would have to charge.
Title: The Bumpy Thread
Post by: evecolonycamander on June 29, 2010, 12:01:48 PM
oh go sit in the corner on you bump for a wile.
Title: The Bumpy Thread
Post by: Hidiot on June 29, 2010, 12:01:48 PM
I shall bump you in the head with a sack of light bulbs.
Title: The Bumpy Thread
Post by: evecolonycamander on June 29, 2010, 12:02:30 PM
and i will, yours with a bump from a log
Title: The Bumpy Thread
Post by: Spikerocks101 on June 29, 2010, 12:43:08 PM
Forest Bump: Life is like a box of chocolates, and your that bad tasting one with the nuts and you always get picked last, or not eaten at all...
Title: The Bumpy Thread
Post by: evecolonycamander on June 29, 2010, 02:54:02 PM
I AM YOUR BUMP ROCK!!!!!!
 
Title: The Bumpy Thread
Post by: Freeza-CII on June 30, 2010, 06:41:36 AM
boom bump
 
Title: The Bumpy Thread
Post by: CK9 on June 30, 2010, 10:29:11 AM
le bump
Title: The Bumpy Thread
Post by: evecolonycamander on June 30, 2010, 04:58:53 PM
BIG BUMP
Title: The Bumpy Thread
Post by: Lord Of Pain on July 24, 2010, 12:45:22 PM
grabbing peelz!!! i mean uh bump!!

*releases mega popup virus sample from youtube below*



http://www.youtube.com/watch?v=xoK1LAz3ufA (http://www.youtube.com/watch?v=xoK1LAz3ufA)


(note just a joke)
Title: The Bumpy Thread
Post by: IclaneKiev on November 23, 2010, 07:01:49 AM
It's fun to bump old threads, expacilly ones that need to die. :P  
Title: The Bumpy Thread
Post by: Betaray on November 23, 2010, 03:13:48 PM
Mobile bump

And the bump thread shall never die! !!
Title: The Bumpy Thread
Post by: Flashy on November 23, 2010, 04:08:54 PM
I never saw such an old bump before! 5 years!

EDIT:
Quote
well, lets see how long it takes us to make 100 pages of bumps

starting........

BUMP
Nearly done! nearly 50 pages in five years, only 5 more years to go!
Title: The Bumpy Thread
Post by: Hidiot on November 23, 2010, 05:53:26 PM
We're not very productive at bumping.
Title: The Bumpy Thread
Post by: Betaray on November 23, 2010, 09:18:47 PM
Man, I remember making that post.  I feel old

Oh yea BUMP
Title: The Bumpy Thread
Post by: CK9 on November 24, 2010, 05:41:32 PM
*goes back to the first bumping page to confirm how old the thread is*
*sees the post from when his GM status was temporarily revoked*

heh, oops

|>.|..|.|\/|.|>
|>.|_|.|. .|.|
Title: The Bumpy Thread
Post by: jcj94 on March 21, 2011, 08:43:31 PM
100 + Bumping pages of bumping glorious bumpiniess BUMP BUMP BUMP BUMP BUMP <- to the Intel humming theme
Title: The Bumpy Thread
Post by: Spikerocks101 on March 21, 2011, 08:54:28 PM
Necro Bumping (cause we moving fast enough as is)
Title: The Bumpy Thread
Post by: CK9 on March 21, 2011, 11:04:50 PM
bumping just because I want to see this get to page 50
Title: The Bumpy Thread
Post by: Lord Of Pain on March 22, 2011, 05:53:15 AM
Get the BUMP off me!
The is no BUMPing way im wearing that dress!

XD
Title: The Bumpy Thread
Post by: jcj94 on March 22, 2011, 06:48:48 AM
BUMPITY BOMPITY BUMP

Bumpo the bumping clown, he bumped until he bumping died, the bumping poor bumpard
Title: The Bumpy Thread
Post by: CK9 on March 22, 2011, 09:37:57 AM
will this bump do it?

yay!  it did!
Title: The Bumpy Thread
Post by: evecolonycamander on March 22, 2011, 10:06:07 AM
speed hump bump
Title: The Bumpy Thread
Post by: Spikerocks101 on March 22, 2011, 12:40:59 PM
Big Umbrella Magic Park
Title: The Bumpy Thread
Post by: Lord Of Pain on March 22, 2011, 01:54:06 PM
I'd like to cook now... hmm lets see what cook book is best for these green...things.... ah yes,

How to:


Boil Up My Peas
Title: The Bumpy Thread
Post by: CK9 on March 22, 2011, 02:36:44 PM
Bring Undue Mischeif, Please
Title: The Bumpy Thread
Post by: jcj94 on March 22, 2011, 05:47:14 PM
Bringing Universal Midgets Plates

BBB.......U.....U...MM...MM...PPP........!!!!
B...B......U.....U...M.MM.M....P...P.......!!!!
BBB.......U....U....M..M...M...PPP........!!!!
B...B........U.U.....M.......M...P
BBB.........UU......M.......M...P.............!!!!

^^^^ ^^^^
EPIC  BUMP

 
Title: The Bumpy Thread
Post by: CK9 on March 22, 2011, 11:50:13 PM
BVMP?  what is BVMP?

:P


bump
Title: The Bumpy Thread
Post by: evecolonycamander on March 23, 2011, 11:08:37 AM
Quote
BVMP?  what is BVMP?
 
big
various
massive
pimples?
--------------------
(http://oi53.tinypic.com/2eeylpg.jpg)
do i need to say it?
Title: The Bumpy Thread
Post by: Venera on March 23, 2011, 11:46:38 AM
i'mnotbumpingthisthread
Title: The Bumpy Thread
Post by: evecolonycamander on March 23, 2011, 12:01:56 PM
Quote
i'mnotbumpingthisthread
youjustdidbumpthisthread:P
Title: The Bumpy Thread
Post by: Venera on March 23, 2011, 12:26:43 PM
noirepliedtothethreadsayingbumpfornoreasonwhatsoever.notsurewhyiamtypinglikethis
Title: The Bumpy Thread
Post by: evecolonycamander on March 23, 2011, 01:01:38 PM
|at|least|your|not|bumping|like|this|.||DAMN|i|just|did|:/|

50th page! <:D
Title: The Bumpy Thread
Post by: jcj94 on March 23, 2011, 01:40:20 PM
[we][gonna][hit][100][freaking][pages][of][bumps][or][else]


[^].[^]
   ^
  Said bump
Title: The Bumpy Thread
Post by: evecolonycamander on March 23, 2011, 03:05:27 PM
BweBneedBmoreBmebersBforBthisBbumpBgameB!B
UweUneedUmoreUmebersUforUthisUbumpUgameU!U
MweMneedMmoreMmebersMforMthisMbumpMgameM!M
PwePneedPmorePmebersPforPthisPbumpPgameP!P
Title: The Bumpy Thread
Post by: jcj94 on March 23, 2011, 05:50:16 PM
Quote
BweBneedBmoreBmebersBforBthisBbumpBgameB!B
UweUneedUmoreUmebersUforUthisUbumpUgameU!U
MweMneedMmoreMmebersMforMthisMbumpMgameM!M
PwePneedPmorePmebersPforPthisPbumpPgameP!P
bumpAbumpNbumpObumpTbumpHbumpEbumpRbump

EPIC bUmp

BU[span style=\'color:orange\']M[span style=\'color:blue\']P[/span][/span]
Title: The Bumpy Thread
Post by: Venera on March 23, 2011, 06:13:48 PM
bumpity bumpity bumpity bump bump bump bumpity bumpity bumpity voumpity boump vump
Title: The Bumpy Thread
Post by: evecolonycamander on March 23, 2011, 07:13:47 PM
bumpLbumpObumpVbumpEbump bumpTbumpHbumpE bumpBUMP bumpTbumpHbumpRbumpEbumpAbumpDbump bumpObumpRbump bumpEbumpLbumpSbumpEbump

what dose it say?
Title: The Bumpy Thread
Post by: Spikerocks101 on March 23, 2011, 08:59:31 PM
A threating message. A casual bumb.
Title: The Bumpy Thread
Post by: evecolonycamander on March 23, 2011, 09:20:01 PM
tonight's forecast calls for heavy BUMPS with a chance of bumping
Title: The Bumpy Thread
Post by: CK9 on March 24, 2011, 10:10:33 AM
I had a lot of bumping olive oil in my breakfast...I don't think I need to mention the end result
Title: The Bumpy Thread
Post by: Lord Of Pain on March 24, 2011, 10:34:37 AM
Ban Uour Melee Peapon!

(For now on, it is illegal to show off your sword)
Title: The Bumpy Thread
Post by: evecolonycamander on March 24, 2011, 10:58:34 AM
Outpost 4: Big Urber Mega Panthers
Title: The Bumpy Thread
Post by: jcj94 on March 24, 2011, 05:19:39 PM
BeccUnoMstealingPmyBideasUforMpostingPbumps!


Thats just not bumping right man
Title: The Bumpy Thread
Post by: evecolonycamander on March 24, 2011, 05:51:33 PM
bumpYbumpObumpUbump bumpJbumpUbumpSbumpTbump bumpSbumpTbumpObumpLbumpEbump bumpMbumpIbumpNbumpEbump bumpFbumpObumpObumpLbump bump :P bump
Title: The Bumpy Thread
Post by: jcj94 on March 24, 2011, 06:15:14 PM
BUMPLOLING
Bump
[size=8]BUMP[/size]
BUMP!
Title: The Bumpy Thread
Post by: evecolonycamander on March 24, 2011, 06:21:17 PM
congratulations on making the 51st page in this bump thread. LETS MAKE 49 MORE PEOPLE!
Title: The Bumpy Thread
Post by: jcj94 on March 24, 2011, 06:22:34 PM
It only says 31 on mine.. Sadbump
Title: The Bumpy Thread
Post by: evecolonycamander on March 24, 2011, 06:53:49 PM
change your board settings to the forum default like i did. then all 51 pages of bumps shall be yours(till i bump again :P)
Title: The Bumpy Thread
Post by: jcj94 on March 24, 2011, 07:21:28 PM
BUMPING for 51 pages...

lets do 51 more
Title: The Bumpy Thread
Post by: evecolonycamander on March 24, 2011, 09:09:54 PM
1205 bumps so far. lets keep going.

EDIT: correction, 1206
Title: The Bumpy Thread
Post by: stillhere on March 25, 2011, 10:54:37 AM
isnt kinda sad that something as lame bump has created the most (or one of the most) replied topics on this site....
Title: The Bumpy Thread
Post by: Spikerocks101 on March 25, 2011, 11:07:44 AM
Whats sad is people come back to this site to bump, but not to play.
Title: The Bumpy Thread
Post by: jcj94 on March 25, 2011, 12:34:53 PM
well, heres a new rule.. maybe.

pick one guys.

They can only bump if they played at least 1 game,
They can only bump if they played at least 1 game that people remember
They can only bump if they play so much that they start dreaming of savant voices explaining their dreamins in some random, haphazard sort of style, that enables you to try and become a tactical genius, and makes you a sort of psycopath.
Title: The Bumpy Thread
Post by: CK9 on March 25, 2011, 12:39:06 PM
but this is a bumping game
Title: The Bumpy Thread
Post by: Spikerocks101 on March 25, 2011, 01:01:12 PM
No rules.. just bumbing.
Title: The Bumpy Thread
Post by: jcj94 on March 25, 2011, 06:37:23 PM
then should we bump in-game

Ore come up with better bump Ideas?
Title: The Bumpy Thread
Post by: evecolonycamander on March 25, 2011, 09:55:16 PM
Quote

They can only bump if they play so much that they start dreaming of savant voices explaining their dreamins in some random, haphazard sort of style, that enables you to try and become a tactical genius, and makes you a sort of psycopath.
dose hearing thors hammer and microwave fire as the AI says 'warning: meat ear approaching' in my head count?
how about the 'command control initiated' i hear every five minutes when i try to sleep?
or the dreams of... wow, i really need a social life.... anyhow, BUMP!

(was going to upload image but i got shut down multiple times and gave up :P )
Title: The Bumpy Thread
Post by: CK9 on March 25, 2011, 11:17:35 PM
bump
Title: The Bumpy Thread
Post by: jcj94 on March 26, 2011, 07:08:48 AM
I wish I was a milionare.. that way I could actually BUy this eden, blue convec that i have on lego's design by Me site, that is really cool.  the downside, it costs aProximately
110$

http://shop.lego.com/Product/Factory/Produ...1d-5ae998edd59d (http://shop.lego.com/Product/Factory/Product.aspx?p=11999&mid=e721d301-4599-4d9b-bd1d-5ae998edd59d)

CLICKY MY LINKY

 
Title: The Bumpy Thread
Post by: Spikerocks101 on March 26, 2011, 07:10:26 AM
This is a Bump thread... and its just $130...
Title: The Bumpy Thread
Post by: jcj94 on March 26, 2011, 08:10:11 AM
BUt i followed all of lev's Marked rules for Posting.
BU................................M...................P..........
Title: The Bumpy Thread
Post by: evecolonycamander on March 26, 2011, 08:58:02 AM
Mabie you should have done it my way. then people would have not questioned the post
Title: The Bumpy Thread
Post by: jcj94 on March 26, 2011, 09:33:17 AM
Because, I like to
Use different ides than what
My
Peers decide to use.
Title: The Bumpy Thread
Post by: evecolonycamander on March 26, 2011, 11:40:55 AM
please,
my
unintelligent
brother could have done better
Title: The Bumpy Thread
Post by: CK9 on March 26, 2011, 06:45:41 PM
but you usually will only maintain credibility with a good post

hiding bumps can be fun
Title: The Bumpy Thread
Post by: jcj94 on March 26, 2011, 06:54:31 PM
Quote
but you usually will only maintain credibility with a good post

 
but you usually will only maintain credibility with a good post

NICE bump hide there CK9

Its an exponential distance between words, YAY Quadratic equations
 
Title: The Bumpy Thread
Post by: evecolonycamander on March 26, 2011, 06:59:37 PM
Quote
Quote
but you usually will only maintain credibility with a good post

 
but you usually will only maintain credibility with a good post

NICE bump hide there CK9

Its an exponential distance between words, YAY Quadratic equations
i doubt he could have thought of that. i mean, who thinks like that on a average basis? though i've been wrong before :P
Title: The Bumpy Thread
Post by: jcj94 on March 26, 2011, 07:07:11 PM
okay, I sat there for 10 minutes, doing NOTHING but looking at your post, and I can't find a bump to save my life.

 
Title: The Bumpy Thread
Post by: evecolonycamander on March 26, 2011, 07:09:31 PM
its there. i hid it very carefully. here is a hint. i turned off smileys for a reason.
so can you find that bump? i'll give you some more ore for you gambling habit :P

EDIT: 52nd page!!!!!
Title: The Bumpy Thread
Post by: jcj94 on March 26, 2011, 07:40:20 PM
Here is a cryptic alphabet.


 B)
 :unsure:
 (thumbsup)
 :P

Can you figure it out?
Title: The Bumpy Thread
Post by: evecolonycamander on March 26, 2011, 07:43:50 PM
Quote
Here is a cryptic alphabet.


 B)
 :unsure:
 (thumbsup)
 :P

Can you figure it out?
B) = B
 :unsure: =U
 (thumbsup)=M
 :P =P

decoded



dɯnq
Title: The Bumpy Thread
Post by: jcj94 on March 26, 2011, 07:46:40 PM
But? upside down?

That is an immoral post.

l c c
v w
n n
l c
Title: The Bumpy Thread
Post by: evecolonycamander on March 26, 2011, 08:04:25 PM
Quote
But? upside down?

That is an immoral post.

l c c
v w
n n
l c

l c c = parts to make upside down B
v w = double U
n n = each a half of M
l c = upside down P

bet you cant find mine without me telling you :P
Title: The Bumpy Thread
Post by: jcj94 on March 26, 2011, 08:10:04 PM
Quote

l c c = parts to make upside down B
v w = double U
n n = each a half of M
l c = upside down P

bet you cant find mine without me telling you :P
Bet = b
you = U
mine/me = M
:P = p

10000110111111010001

AND

1011
11110
10110
11001
Title: The Bumpy Thread
Post by: evecolonycamander on March 26, 2011, 08:21:31 PM



[DoHtml]
<table border=0 cellpadding=0 cellspacing=0 background="html/emoticons/bump2.gif" width=100% height=100>
  <tr>
   <td align=center>
      <center><font color=black>This is not the bump your looking for.</font></center>
   </td>
  </tr>
</table>
[/DoHtml]
Title: The Bumpy Thread
Post by: jcj94 on March 26, 2011, 08:24:48 PM
Quote
[DoHtml]
<table border=0 cellpadding=0 cellspacing=0 background="html/emoticons/bump2.gif" width=100% height=100>
  <tr>
   <td align=center>
      <center><font color=black>This is not the bump your looking for.</font></center>
   </td>
  </tr>
</table>
[/DoHtml]
that is just overkill

AA
JEA
JAAA
JE
 
Title: The Bumpy Thread
Post by: evecolonycamander on March 26, 2011, 08:29:17 PM
Quote
[DoHtml]<font size="-3">
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMP</font><font color=#330000>B</font><font color=#920000>UMPBUMPBUM</font><font color=#870000>P</font><font color=#6c0000>B</font><font color=#460000>U</font><font color=#150000>M</font><font color=black>PBUMPB</font><font color=#3b0000>U</font><font color=#920000>MPB</font><font color=#3a0000>U</font><font color=black>MPBUMPBUM</font><font color=#260000>P</font><font color=#920000>BUM</font><font color=#4f0000>P</font><font color=black>BUMP</font><font color=#790000>B</font><font color=#920000>UMPB</font><font color=#790000>U</font><font color=#040000>M</font><font color=black>PBUMPBUM</font><font color=#2c0000>P</font><font color=#920000>BUMPB</font><font color=#380000>U</font><font color=black>MPBU</font><font color=#690000>M</font><font color=#920000>PBUMPBUMPBU</font><font color=maroon>M</font><font color=#6b0000>P</font><font color=#490000>B</font><font color=#130000>U</font><font color=black>MPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBU</font><font color=#590000>M</font><font color=red>PBU</font><font color=#e40000>M</font><font color=#cc0000>PBUM</font><font color=#df0000>P</font><font color=#e90000>B</font><font color=#f10000>U</font><font color=#fe0000>M</font><font color=#fb0000>P</font><font color=#f00000>B</font><font color=#aa0000>U</font><font color=#1f0000>M</font><font color=black>PBUM</font><font color=#670000>P</font><font color=red>BUM</font><font color=#660000>P</font><font color=black>BUMPBUMPB</font><font color=#430000>U</font><font color=red>MPB</font><font color=#8b0000>U</font><font color=black>MPBU</font><font color=#d40000>M</font><font color=red>PBUM</font><font color=#fe0000>P</font><font color=#700000>B</font><font color=black>UMPBUMP</font><font color=#110000>B</font><font color=#d00000>U</font><font color=red>MPBUM</font><font color=#610000>P</font><font color=black>BUMP</font><font color=#b90000>B</font><font color=red>UMP</font><font color=#d00000>B</font><font color=#cc0000>UMPB</font><font color=#ce0000>U</font><font color=#e30000>M</font><font color=#e90000>P</font><font color=#f50000>B</font><font color=red>U</font><font color=#fc0000>M</font><font color=#ed0000>P</font><font color=#8c0000>B</font><font color=#0e0000>U</font><font color=black>MPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMP</font><font color=#590000>B</font><font color=red>UMP</font><font color=#750000>B</font><font color=black>UMPB</font><font color=#010000>U</font><font color=#040000>M</font><font color=#230000>P</font><font color=#8f0000>B</font><font color=red>UMP</font><font color=#a70000>B</font><font color=black>UMPB</font><font color=#670000>U</font><font color=red>MPB</font><font color=#660000>U</font><font color=black>MPBUMPBUM</font><font color=#430000>P</font><font color=red>BUM</font><font color=#8b0000>P</font><font color=black>BUMP</font><font color=#d40000>B</font><font color=red>UMPBU</font><font color=#f30000>M</font><font color=#350000>P</font><font color=black>BUMPB</font><font color=#020000>U</font><font color=#9b0000>M</font><font color=red>PBUMPB</font><font color=#610000>U</font><font color=black>MPBU</font><font color=#b90000>M</font><font color=red>PBU</font><font color=#150000>M</font><font color=black>PBUMP</font><font color=#010000>B</font><font color=#050000>U</font><font color=#310000>M</font><font color=#b30000>P</font><font color=red>BUM</font><font color=#900000>P</font><font color=black>BUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBU</font><font color=#590000>M</font><font color=red>PBU</font><font color=#750000>M</font><font color=black>PBUMP</font><font color=#020000>B</font><font color=#1a0000>U</font><font color=#900000>M</font><font color=red>PBU</font><font color=#8b0000>M</font><font color=black>PBUM</font><font color=#670000>P</font><font color=red>BUM</font><font color=#660000>P</font><font color=black>BUMPBUMPB</font><font color=#430000>U</font><font color=red>MPB</font><font color=#8b0000>U</font><font color=black>MPBU</font><font color=#d40000>M</font><font color=red>PB</font><font color=#fb0000>U</font><font color=#c00000>M</font><font color=red>PB</font><font color=#d20000>U</font><font color=#0e0000>M</font><font color=black>PBUM</font><font color=#590000>P</font><font color=#fb0000>B</font><font color=red>U</font><font color=#fe0000>M</font><font color=#bc0000>P</font><font color=red>BUM</font><font color=#610000>P</font><font color=black>BUMP</font><font color=#b90000>B</font><font color=red>UMP</font><font color=#150000>B</font><font color=black>UMPBUMPB</font><font color=#570000>U</font><font color=red>MPB</font><font color=#ad0000>U</font><font color=black>MPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMP</font><font color=#590000>B</font><font color=red>UMP</font><font color=#e30000>B</font><font color=#cc0000>UMPB</font><font color=#da0000>U</font><font color=#eb0000>M</font><font color=#f80000>P</font><font color=#fe0000>B</font><font color=red>U</font><font color=#e50000>M</font><font color=#710000>P</font><font color=#070000>B</font><font color=black>UMPB</font><font color=#670000>U</font><font color=red>MPB</font><font color=#660000>U</font><font color=black>MPBUMPBUM</font><font color=#430000>P</font><font color=red>BUM</font><font color=#8b0000>P</font><font color=black>BUMP</font><font color=#d40000>B</font><font color=red>UM</font><font color=#f90000>P</font><font color=#1a0000>B</font><font color=#e30000>U</font><font color=red>MP</font><font color=#a00000>B</font><font color=#030000>U</font><font color=black>MP</font><font color=#2a0000>B</font><font color=#ef0000>U</font><font color=red>M</font><font color=#fe0000>P</font><font color=#8a0000>B</font><font color=#6e0000>U</font><font color=red>MPB</font><font color=#610000>U</font><font color=black>MPBU</font><font color=#b90000>M</font><font color=red>PBU</font><font color=#4a0000>M</font><font color=#3a0000>PBUM</font><font color=#3e0000>P</font><font color=#550000>B</font><font color=#660000>U</font><font color=#9f0000>M</font><font color=#f30000>P</font><font color=red>BU</font><font color=#e80000>M</font><font color=#450000>P</font><font color=black>BUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBU</font><font color=#590000>M</font><font color=red>PBU</font><font color=#c40000>M</font><font color=#920000>PBUM</font><font color=#980000>P</font><font color=#ac0000>B</font><font color=#b60000>U</font><font color=#d20000>M</font><font color=#fb0000>P</font><font color=red>B</font><font color=#e80000>U</font><font color=#a10000>M</font><font color=#1f0000>P</font><font color=black>BUM</font><font color=#670000>P</font><font color=red>BUM</font><font color=#660000>P</font><font color=black>BUMPBUMPB</font><font color=#430000>U</font><font color=red>MPB</font><font color=#8b0000>U</font><font color=black>MPBU</font><font color=#d40000>M</font><font color=red>PB</font><font color=#f90000>U</font><font color=black>M</font><font color=#470000>P</font><font color=#f70000>B</font><font color=red>U</font><font color=#fb0000>M</font><font color=#5f0000>P</font><font color=black>B</font><font color=#0d0000>U</font><font color=#c70000>M</font><font color=red>PB</font><font color=#c00000>U</font><font color=#0a0000>M</font><font color=#6d0000>P</font><font color=red>BUM</font><font color=#610000>P</font><font color=black>BUMP</font><font color=#b90000>B</font><font color=red>UMP</font><font color=#fe0000>BUMPBUM</font><font color=#fc0000>P</font><font color=#ed0000>B</font><font color=#da0000>U</font><font color=#bc0000>M</font><font color=#7a0000>P</font><font color=#210000>B</font><font color=black>UMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMP</font><font color=#590000>B</font><font color=red>UMP</font><font color=#750000>B</font><font color=black>UMPBUM</font><font color=#020000>P</font><font color=#0e0000>B</font><font color=#580000>U</font><font color=red>MPB</font><font color=#c20000>U</font><font color=#030000>M</font><font color=black>PB</font><font color=#670000>U</font><font color=red>MPB</font><font color=#9a0000>U</font><font color=black>MPBUMPBUM</font><font color=#760000>P</font><font color=red>BUM</font><font color=#8b0000>P</font><font color=black>BUMP</font><font color=#d40000>B</font><font color=red>UM</font><font color=#f90000>P</font><font color=black>B</font><font color=#010000>U</font><font color=#7b0000>M</font><font color=red>PB</font><font color=#ed0000>U</font><font color=#250000>M</font><font color=#8d0000>P</font><font color=red>BU</font><font color=#e70000>M</font><font color=#220000>P</font><font color=black>B</font><font color=#6d0000>U</font><font color=red>MPB</font><font color=#610000>U</font><font color=black>MPBU</font><font color=#b90000>M</font><font color=red>PBU</font><font color=#380000>M</font><font color=#260000>PBUMPB</font><font color=#250000>U</font><font color=#1d0000>M</font><font color=#120000>P</font><font color=#050000>B</font><font color=black>UMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBU</font><font color=#590000>M</font><font color=red>PBU</font><font color=#750000>M</font><font color=black>PBUMPB</font><font color=#030000>U</font><font color=#130000>M</font><font color=#610000>P</font><font color=red>BUM</font><font color=#cf0000>P</font><font color=#040000>B</font><font color=black>UM</font><font color=#2a0000>P</font><font color=#f50000>B</font><font color=red>UM</font><font color=#f20000>P</font><font color=#450000>B</font><font color=#0a0000>U</font><font color=black>MPBUM</font><font color=#070000>P</font><font color=#340000>B</font><font color=#e20000>U</font><font color=red>MP</font><font color=#fc0000>B</font><font color=#4d0000>U</font><font color=black>MPBU</font><font color=#d40000>M</font><font color=red>PB</font><font color=#f90000>U</font><font color=black>MP</font><font color=#020000>B</font><font color=#ac0000>U</font><font color=red>MP</font><font color=#e10000>B</font><font color=#fc0000>U</font><font color=red>M</font><font color=#f70000>P</font><font color=#420000>B</font><font color=black>UM</font><font color=#6d0000>P</font><font color=red>BUM</font><font color=#610000>P</font><font color=black>BUMP</font><font color=#b90000>B</font><font color=red>UMP</font><font color=#150000>B</font><font color=black>UMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMP</font><font color=#590000>B</font><font color=red>UMP</font><font color=#c40000>B</font><font color=#920000>UMPB</font><font color=#930000>U</font><font color=#ab0000>M</font><font color=#ba0000>P</font><font color=#db0000>B</font><font color=#fd0000>U</font><font color=red>M</font><font color=#fd0000>P</font><font color=#c90000>B</font><font color=#360000>U</font><font color=black>MPBU</font><font color=#5c0000>M</font><font color=#dd0000>P</font><font color=red>BU</font><font color=#f80000>M</font><font color=#c90000>P</font><font color=#a20000>B</font><font color=#8e0000>U</font><font color=#7a0000>M</font><font color=#8c0000>P</font><font color=#9e0000>B</font><font color=#c30000>U</font><font color=#f30000>M</font><font color=red>PB</font><font color=#ea0000>U</font><font color=#770000>M</font><font color=black>PBUMP</font><font color=#d40000>B</font><font color=red>UM</font><font color=#f90000>P</font><font color=black>BUM</font><font color=#170000>P</font><font color=#da0000>B</font><font color=red>UMP</font><font color=#fe0000>B</font><font color=#7e0000>U</font><font color=#010000>M</font><font color=black>PB</font><font color=#6d0000>U</font><font color=red>MPB</font><font color=#610000>U</font><font color=black>MPBU</font><font color=#b90000>M</font><font color=red>PBU</font><font color=#150000>M</font><font color=black>PBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBU</font><font color=#470000>M</font><font color=#cc0000>PBUMPBUMPBU</font><font color=#b60000>M</font><font color=#9c0000>P</font><font color=#720000>B</font><font color=#350000>U</font><font color=#0c0000>M</font><font color=black>PBUMPB</font><font color=#110000>U</font><font color=#530000>M</font><font color=#930000>P</font><font color=#bf0000>B</font><font color=#da0000>U</font><font color=#e90000>MPBUM</font><font color=#d80000>P</font><font color=#bf0000>B</font><font color=#9a0000>U</font><font color=#5d0000>M</font><font color=#190000>P</font><font color=#010000>B</font><font color=black>UMPBU</font><font color=#aa0000>M</font><font color=#cc0000>PB</font><font color=#c70000>U</font><font color=black>MPBU</font><font color=#3a0000>M</font><font color=#c90000>P</font><font color=#cc0000>BU</font><font color=#a10000>M</font><font color=#060000>P</font><font color=black>BUM</font><font color=#570000>P</font><font color=#cc0000>BUM</font><font color=#4e0000>P</font><font color=black>BUMP</font><font color=#940000>B</font><font color=#cc0000>UMP</font><font color=#110000>B</font><font color=black>UMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>


</font>
[/DoHtml]

put in quote box to fix error
Title: The Bumpy Thread
Post by: jcj94 on March 26, 2011, 08:30:25 PM
Quote
[DoHtml]<font size="-3">
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMP</font><font color=#330000>B</font><font color=#920000>UMPBUMPBUM</font><font color=#870000>P</font><font color=#6c0000>B</font><font color=#460000>U</font><font color=#150000>M</font><font color=black>PBUMPB</font><font color=#3b0000>U</font><font color=#920000>MPB</font><font color=#3a0000>U</font><font color=black>MPBUMPBUM</font><font color=#260000>P</font><font color=#920000>BUM</font><font color=#4f0000>P</font><font color=black>BUMP</font><font color=#790000>B</font><font color=#920000>UMPB</font><font color=#790000>U</font><font color=#040000>M</font><font color=black>PBUMPBUM</font><font color=#2c0000>P</font><font color=#920000>BUMPB</font><font color=#380000>U</font><font color=black>MPBU</font><font color=#690000>M</font><font color=#920000>PBUMPBUMPBU</font><font color=maroon>M</font><font color=#6b0000>P</font><font color=#490000>B</font><font color=#130000>U</font><font color=black>MPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBU</font><font color=#590000>M</font><font color=red>PBU</font><font color=#e40000>M</font><font color=#cc0000>PBUM</font><font color=#df0000>P</font><font color=#e90000>B</font><font color=#f10000>U</font><font color=#fe0000>M</font><font color=#fb0000>P</font><font color=#f00000>B</font><font color=#aa0000>U</font><font color=#1f0000>M</font><font color=black>PBUM</font><font color=#670000>P</font><font color=red>BUM</font><font color=#660000>P</font><font color=black>BUMPBUMPB</font><font color=#430000>U</font><font color=red>MPB</font><font color=#8b0000>U</font><font color=black>MPBU</font><font color=#d40000>M</font><font color=red>PBUM</font><font color=#fe0000>P</font><font color=#700000>B</font><font color=black>UMPBUMP</font><font color=#110000>B</font><font color=#d00000>U</font><font color=red>MPBUM</font><font color=#610000>P</font><font color=black>BUMP</font><font color=#b90000>B</font><font color=red>UMP</font><font color=#d00000>B</font><font color=#cc0000>UMPB</font><font color=#ce0000>U</font><font color=#e30000>M</font><font color=#e90000>P</font><font color=#f50000>B</font><font color=red>U</font><font color=#fc0000>M</font><font color=#ed0000>P</font><font color=#8c0000>B</font><font color=#0e0000>U</font><font color=black>MPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMP</font><font color=#590000>B</font><font color=red>UMP</font><font color=#750000>B</font><font color=black>UMPB</font><font color=#010000>U</font><font color=#040000>M</font><font color=#230000>P</font><font color=#8f0000>B</font><font color=red>UMP</font><font color=#a70000>B</font><font color=black>UMPB</font><font color=#670000>U</font><font color=red>MPB</font><font color=#660000>U</font><font color=black>MPBUMPBUM</font><font color=#430000>P</font><font color=red>BUM</font><font color=#8b0000>P</font><font color=black>BUMP</font><font color=#d40000>B</font><font color=red>UMPBU</font><font color=#f30000>M</font><font color=#350000>P</font><font color=black>BUMPB</font><font color=#020000>U</font><font color=#9b0000>M</font><font color=red>PBUMPB</font><font color=#610000>U</font><font color=black>MPBU</font><font color=#b90000>M</font><font color=red>PBU</font><font color=#150000>M</font><font color=black>PBUMP</font><font color=#010000>B</font><font color=#050000>U</font><font color=#310000>M</font><font color=#b30000>P</font><font color=red>BUM</font><font color=#900000>P</font><font color=black>BUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBU</font><font color=#590000>M</font><font color=red>PBU</font><font color=#750000>M</font><font color=black>PBUMP</font><font color=#020000>B</font><font color=#1a0000>U</font><font color=#900000>M</font><font color=red>PBU</font><font color=#8b0000>M</font><font color=black>PBUM</font><font color=#670000>P</font><font color=red>BUM</font><font color=#660000>P</font><font color=black>BUMPBUMPB</font><font color=#430000>U</font><font color=red>MPB</font><font color=#8b0000>U</font><font color=black>MPBU</font><font color=#d40000>M</font><font color=red>PB</font><font color=#fb0000>U</font><font color=#c00000>M</font><font color=red>PB</font><font color=#d20000>U</font><font color=#0e0000>M</font><font color=black>PBUM</font><font color=#590000>P</font><font color=#fb0000>B</font><font color=red>U</font><font color=#fe0000>M</font><font color=#bc0000>P</font><font color=red>BUM</font><font color=#610000>P</font><font color=black>BUMP</font><font color=#b90000>B</font><font color=red>UMP</font><font color=#150000>B</font><font color=black>UMPBUMPB</font><font color=#570000>U</font><font color=red>MPB</font><font color=#ad0000>U</font><font color=black>MPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMP</font><font color=#590000>B</font><font color=red>UMP</font><font color=#e30000>B</font><font color=#cc0000>UMPB</font><font color=#da0000>U</font><font color=#eb0000>M</font><font color=#f80000>P</font><font color=#fe0000>B</font><font color=red>U</font><font color=#e50000>M</font><font color=#710000>P</font><font color=#070000>B</font><font color=black>UMPB</font><font color=#670000>U</font><font color=red>MPB</font><font color=#660000>U</font><font color=black>MPBUMPBUM</font><font color=#430000>P</font><font color=red>BUM</font><font color=#8b0000>P</font><font color=black>BUMP</font><font color=#d40000>B</font><font color=red>UM</font><font color=#f90000>P</font><font color=#1a0000>B</font><font color=#e30000>U</font><font color=red>MP</font><font color=#a00000>B</font><font color=#030000>U</font><font color=black>MP</font><font color=#2a0000>B</font><font color=#ef0000>U</font><font color=red>M</font><font color=#fe0000>P</font><font color=#8a0000>B</font><font color=#6e0000>U</font><font color=red>MPB</font><font color=#610000>U</font><font color=black>MPBU</font><font color=#b90000>M</font><font color=red>PBU</font><font color=#4a0000>M</font><font color=#3a0000>PBUM</font><font color=#3e0000>P</font><font color=#550000>B</font><font color=#660000>U</font><font color=#9f0000>M</font><font color=#f30000>P</font><font color=red>BU</font><font color=#e80000>M</font><font color=#450000>P</font><font color=black>BUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBU</font><font color=#590000>M</font><font color=red>PBU</font><font color=#c40000>M</font><font color=#920000>PBUM</font><font color=#980000>P</font><font color=#ac0000>B</font><font color=#b60000>U</font><font color=#d20000>M</font><font color=#fb0000>P</font><font color=red>B</font><font color=#e80000>U</font><font color=#a10000>M</font><font color=#1f0000>P</font><font color=black>BUM</font><font color=#670000>P</font><font color=red>BUM</font><font color=#660000>P</font><font color=black>BUMPBUMPB</font><font color=#430000>U</font><font color=red>MPB</font><font color=#8b0000>U</font><font color=black>MPBU</font><font color=#d40000>M</font><font color=red>PB</font><font color=#f90000>U</font><font color=black>M</font><font color=#470000>P</font><font color=#f70000>B</font><font color=red>U</font><font color=#fb0000>M</font><font color=#5f0000>P</font><font color=black>B</font><font color=#0d0000>U</font><font color=#c70000>M</font><font color=red>PB</font><font color=#c00000>U</font><font color=#0a0000>M</font><font color=#6d0000>P</font><font color=red>BUM</font><font color=#610000>P</font><font color=black>BUMP</font><font color=#b90000>B</font><font color=red>UMP</font><font color=#fe0000>BUMPBUM</font><font color=#fc0000>P</font><font color=#ed0000>B</font><font color=#da0000>U</font><font color=#bc0000>M</font><font color=#7a0000>P</font><font color=#210000>B</font><font color=black>UMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMP</font><font color=#590000>B</font><font color=red>UMP</font><font color=#750000>B</font><font color=black>UMPBUM</font><font color=#020000>P</font><font color=#0e0000>B</font><font color=#580000>U</font><font color=red>MPB</font><font color=#c20000>U</font><font color=#030000>M</font><font color=black>PB</font><font color=#670000>U</font><font color=red>MPB</font><font color=#9a0000>U</font><font color=black>MPBUMPBUM</font><font color=#760000>P</font><font color=red>BUM</font><font color=#8b0000>P</font><font color=black>BUMP</font><font color=#d40000>B</font><font color=red>UM</font><font color=#f90000>P</font><font color=black>B</font><font color=#010000>U</font><font color=#7b0000>M</font><font color=red>PB</font><font color=#ed0000>U</font><font color=#250000>M</font><font color=#8d0000>P</font><font color=red>BU</font><font color=#e70000>M</font><font color=#220000>P</font><font color=black>B</font><font color=#6d0000>U</font><font color=red>MPB</font><font color=#610000>U</font><font color=black>MPBU</font><font color=#b90000>M</font><font color=red>PBU</font><font color=#380000>M</font><font color=#260000>PBUMPB</font><font color=#250000>U</font><font color=#1d0000>M</font><font color=#120000>P</font><font color=#050000>B</font><font color=black>UMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBU</font><font color=#590000>M</font><font color=red>PBU</font><font color=#750000>M</font><font color=black>PBUMPB</font><font color=#030000>U</font><font color=#130000>M</font><font color=#610000>P</font><font color=red>BUM</font><font color=#cf0000>P</font><font color=#040000>B</font><font color=black>UM</font><font color=#2a0000>P</font><font color=#f50000>B</font><font color=red>UM</font><font color=#f20000>P</font><font color=#450000>B</font><font color=#0a0000>U</font><font color=black>MPBUM</font><font color=#070000>P</font><font color=#340000>B</font><font color=#e20000>U</font><font color=red>MP</font><font color=#fc0000>B</font><font color=#4d0000>U</font><font color=black>MPBU</font><font color=#d40000>M</font><font color=red>PB</font><font color=#f90000>U</font><font color=black>MP</font><font color=#020000>B</font><font color=#ac0000>U</font><font color=red>MP</font><font color=#e10000>B</font><font color=#fc0000>U</font><font color=red>M</font><font color=#f70000>P</font><font color=#420000>B</font><font color=black>UM</font><font color=#6d0000>P</font><font color=red>BUM</font><font color=#610000>P</font><font color=black>BUMP</font><font color=#b90000>B</font><font color=red>UMP</font><font color=#150000>B</font><font color=black>UMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMP</font><font color=#590000>B</font><font color=red>UMP</font><font color=#c40000>B</font><font color=#920000>UMPB</font><font color=#930000>U</font><font color=#ab0000>M</font><font color=#ba0000>P</font><font color=#db0000>B</font><font color=#fd0000>U</font><font color=red>M</font><font color=#fd0000>P</font><font color=#c90000>B</font><font color=#360000>U</font><font color=black>MPBU</font><font color=#5c0000>M</font><font color=#dd0000>P</font><font color=red>BU</font><font color=#f80000>M</font><font color=#c90000>P</font><font color=#a20000>B</font><font color=#8e0000>U</font><font color=#7a0000>M</font><font color=#8c0000>P</font><font color=#9e0000>B</font><font color=#c30000>U</font><font color=#f30000>M</font><font color=red>PB</font><font color=#ea0000>U</font><font color=#770000>M</font><font color=black>PBUMP</font><font color=#d40000>B</font><font color=red>UM</font><font color=#f90000>P</font><font color=black>BUM</font><font color=#170000>P</font><font color=#da0000>B</font><font color=red>UMP</font><font color=#fe0000>B</font><font color=#7e0000>U</font><font color=#010000>M</font><font color=black>PB</font><font color=#6d0000>U</font><font color=red>MPB</font><font color=#610000>U</font><font color=black>MPBU</font><font color=#b90000>M</font><font color=red>PBU</font><font color=#150000>M</font><font color=black>PBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBU</font><font color=#470000>M</font><font color=#cc0000>PBUMPBUMPBU</font><font color=#b60000>M</font><font color=#9c0000>P</font><font color=#720000>B</font><font color=#350000>U</font><font color=#0c0000>M</font><font color=black>PBUMPB</font><font color=#110000>U</font><font color=#530000>M</font><font color=#930000>P</font><font color=#bf0000>B</font><font color=#da0000>U</font><font color=#e90000>MPBUM</font><font color=#d80000>P</font><font color=#bf0000>B</font><font color=#9a0000>U</font><font color=#5d0000>M</font><font color=#190000>P</font><font color=#010000>B</font><font color=black>UMPBU</font><font color=#aa0000>M</font><font color=#cc0000>PB</font><font color=#c70000>U</font><font color=black>MPBU</font><font color=#3a0000>M</font><font color=#c90000>P</font><font color=#cc0000>BU</font><font color=#a10000>M</font><font color=#060000>P</font><font color=black>BUM</font><font color=#570000>P</font><font color=#cc0000>BUM</font><font color=#4e0000>P</font><font color=black>BUMP</font><font color=#940000>B</font><font color=#cc0000>UMP</font><font color=#110000>B</font><font color=black>UMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>
<font color=black>BUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBU</font>
<font color=black>MPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMPBUMP</font>


</font>
[/DoHtml]
FING OVER KILL

and you didn't solve my last bump...
 
Title: The Bumpy Thread
Post by: CK9 on March 27, 2011, 10:06:55 AM
Удар
זעץ
نتوء
Զարկել


can you guess the type of bump? (hint: all four fit into a single category)

edit: increased size to increase visibility
Title: The Bumpy Thread
Post by: evecolonycamander on March 27, 2011, 10:44:54 AM
Quote
Удар
זעץ
نتوء
Զարկել


can you guess the type of bump? (hint: all four fit into a single category)

edit: increased size to increase visibility
isnt the third Arabic? or is all of it?. hmm... guess using a translator is in order
bump(to lazy to do an animated one :P)
Title: The Bumpy Thread
Post by: jcj94 on March 27, 2011, 11:15:27 AM
The first one is russian.

All based off the Cyrillic alphabet.

Find it this time ECC.
Title: The Bumpy Thread
Post by: evecolonycamander on March 27, 2011, 02:00:12 PM
Quote
The first one is russian.

All based off the Cyrillic alphabet.

Find it this time ECC.
The first one is russian.

All based off the Cyrillic alphabet.

Find it this time ECC.
------------
pnwd

(its there. you have to look)
Title: The Bumpy Thread
Post by: jcj94 on March 27, 2011, 02:29:06 PM
mebmer no.=B
post # = P
you = U
member no.=M

Yeah, its there.

(http://static.ak.fbcdn.net/images/emote/penguin.gif)
Title: The Bumpy Thread
Post by: evecolonycamander on March 27, 2011, 04:19:56 PM
actualy mine was pnwd. each is a twisted version of the word bump.
P =b
n= u
w= M
d=p
Title: The Bumpy Thread
Post by: jcj94 on March 27, 2011, 07:19:27 PM
<-  its there.

Right there

Sadly, noone can see it

your all slow

you can't get it

unless your using MY profile skin

You won't be able to view it.

but its their.
Title: The Bumpy Thread
Post by: evecolonycamander on March 27, 2011, 07:36:21 PM
[dohtml]
<blink>Blinking Bumps D:</blink>
[/dohtml]
Title: The Bumpy Thread
Post by: jcj94 on March 27, 2011, 07:38:24 PM
OMFG
omfg

now find mine in THIS one
Title: The Bumpy Thread
Post by: jcj94 on March 27, 2011, 07:42:02 PM
Quote
since I'm no longer a GM, I don't have any need to set an example anymore.  You all (or at least those who were at kiler's forum) know what that means!

SMILEY SPAM!!!! bump style:




  (xp)  :Cool:  (thumbsup)  (thumbsdown)  [OT]  :Luweeg:  :plymoth:  :stop:  :bump:  :anibump:

edit (3/21/2011): For those who were not here, this post was during a bit of a controversial point in the community history.  Please do not immitate this post :P
DOUBLE BUMP for 1
and
But CK9

Tricks are for kids.

Fine then Nappa.  Catch it.  catch it with your teeth.
Title: The Bumpy Thread
Post by: evecolonycamander on March 27, 2011, 07:45:04 PM
there was a reason i didn't quote that one. oh well, whats done is done.
BUMP
 
Title: The Bumpy Thread
Post by: jcj94 on March 27, 2011, 08:04:49 PM
Ima on a boat
and
its going bump and
 
Title: The Bumpy Thread
Post by: Spikerocks101 on March 27, 2011, 08:28:06 PM
Quote
Fine then Nappa.  Catch it.  catch it with your teeth.
You better as hell have watched the original Dragon Ballz, or I am going to go Super Sayain on your ass.

oh, and bumb
Title: The Bumpy Thread
Post by: jcj94 on March 29, 2011, 06:59:58 AM
I watched, but didn't enjoy, the original so HAH.

BWAM - take that moon.  Perfect orbit my ass.
Title: The Bumpy Thread
Post by: Lord Of Pain on March 29, 2011, 10:48:42 AM
there was an old farmer who lived on a rock, then he got angry and started shaking his fist, at the boys on the crick, then down came a laddy she showed them her roffles, which gave them good luck, she said she was teaching her kids a new way to play, kill that boar, down came another she looked like a pretty, young fellow who knew a man named chuck,

and if you think this is dirty you can go BUMP yourself XD :P
Title: The Bumpy Thread
Post by: jcj94 on March 29, 2011, 01:34:27 PM
congrats, 53 page LoP

stop using the Assumption Song.

PST. (find it now)

:P :o ;) B)  (thumbsup)
Title: The Bumpy Thread
Post by: evecolonycamander on March 29, 2011, 02:01:42 PM
Quote
:huh:

Rules:

    * Your post MUST have bump in it
    * You may not bump twice in a row
    * It doesn't matter how you bump, so long as you bump

/me bumps

<_<
quote/necro bump :P
Title: The Bumpy Thread
Post by: jcj94 on March 29, 2011, 02:03:12 PM
You can't necro a spam topic

Yeah BUMP that SirBomber :P
Title: The Bumpy Thread
Post by: evecolonycamander on March 29, 2011, 02:55:43 PM
i think the next member to bump will be jcj94
Title: The Bumpy Thread
Post by: jcj94 on March 29, 2011, 03:26:48 PM
must.. not.... bump.... CRAP
 
Title: The Bumpy Thread
Post by: evecolonycamander on March 29, 2011, 04:09:25 PM
the bump compels you
Title: The Bumpy Thread
Post by: jcj94 on March 29, 2011, 05:11:17 PM
5.4.3.2.1.
ECC THE POWER OF THE .... COMPELS YOU
Title: The Bumpy Thread
Post by: evecolonycamander on March 30, 2011, 06:03:51 PM
READ THE THREAD RULES JCJ94 :P
[size=0]Microscopic Bump. I bet the only person who will see this is quoting it[/size]
 
Title: The Bumpy Thread
Post by: jcj94 on March 30, 2011, 06:04:23 PM
HAH the power of the bump compeled him.
Title: The Bumpy Thread
Post by: evecolonycamander on March 30, 2011, 06:07:34 PM
did i actually say the magic word? im pretty sure i did not. i mean, it's not even on there. go ahead and highlight it. NOT THERE. [size=0]LMAO, i just hope this size option is universal. cause if it's not im looking like an ass .  BUMP[/size]
Title: The Bumpy Thread
Post by: jcj94 on March 30, 2011, 06:18:19 PM
[size=0]You can't see this post of the epic bump either.[/size]
Title: The Bumpy Thread
Post by: evecolonycamander on March 30, 2011, 07:04:44 PM
Quote
[size=0]You can't see this post of the epic bump either.[/size]
you fool, your supposed to write some non-hidden text to throw me off. BUMP
Title: The Bumpy Thread
Post by: jcj94 on April 03, 2011, 06:31:23 PM
Why bother, you wouldn't look in the first place ECC

Now off to Cleveland!  My Lucky 13 robot.
Title: The Bumpy Thread
Post by: Freeza-CII on April 08, 2011, 05:04:10 PM
jcj94 you are a small boat of fail in my sea of win say bump in every post or ill ban you for ruining a on going tradition.
Title: The Bumpy Thread
Post by: jcj94 on April 08, 2011, 08:55:17 PM
Its there, its hidden.  Me and ECC have been hiding them for a while.

BUMPITYBUMPITYBUMPITYBUMPITY
Title: The Bumpy Thread
Post by: evecolonycamander on April 09, 2011, 12:01:55 AM
quote his post and read the quote.... it's there. we use size -7 text to hide em' :P
[size=0]BUMP[/size]
Title: The Bumpy Thread
Post by: Venera on April 09, 2011, 04:40:33 AM
BUMP goes the weasel!
Title: The Bumpy Thread
Post by: Sirbomber on April 09, 2011, 06:06:40 AM
Quote
Its there, its hidden.  Me and ECC have been hiding them for a while.
Congrats on completely missing the point of the game, fools.  Make your bump obvious or the Bumpy God (Freeza) will use his Ownage Stick on you.
Title: The Bumpy Thread
Post by: Freeza-CII on April 09, 2011, 10:32:42 PM
glad i am still thought of so highly after my long absences from the irc and forums. bump
Title: The Bumpy Thread
Post by: evecolonycamander on April 09, 2011, 11:02:25 PM
Quote
glad i am still thought of so highly after my long absences from the irc and forums. bump
no, we just keep up appearances :P (JK)
BMUPBUMBPUBMPBUPMBPBPBMPBPBUPMPBMUBMBPBUMP
Title: The Bumpy Thread
Post by: Freeza-CII on April 10, 2011, 05:51:40 AM
That joke might be funnier if it made any sense. bump
Title: The Bumpy Thread
Post by: jcj94 on April 10, 2011, 07:42:27 AM
Look who your bumping talking to.... ;p
Title: The Bumpy Thread
Post by: Freeza-CII on April 11, 2011, 12:35:52 AM
hmmm I think they dont know who I am. Bump.
Title: The Bumpy Thread
Post by: jcj94 on April 11, 2011, 06:52:24 AM
Your 111 Mr ... *gets frozen and bumps my head on the table falling over*

PS. WOOT 54th page O bump
Title: The Bumpy Thread
Post by: Freeza-CII on April 11, 2011, 09:47:27 AM
simply horrible. bump.
Title: The Bumpy Thread
Post by: jcj94 on April 11, 2011, 01:59:18 PM
BUMPITY BUMPITY BUMPITY bumpity.  Its the new easter bunny song.
Title: The Bumpy Thread
Post by: evecolonycamander on April 11, 2011, 02:32:08 PM
Pie is all-mighty and universally brilliant
Title: The Bumpy Thread
Post by: jcj94 on April 11, 2011, 07:20:42 PM
Quote
Pie is all-mighty and universally brilliant
BUMP BURN
Title: The Bumpy Thread
Post by: CK9 on April 11, 2011, 09:51:20 PM
bum bum bum bum bum bum bum bum bum bum bum bum bum bum bum bum bum bum bum bum bum..........................d

:P
Title: The Bumpy Thread
Post by: Bonk on April 12, 2011, 03:47:23 AM
How does one bump this thread?
Title: The Bumpy Thread
Post by: Freeza-CII on April 12, 2011, 07:01:10 AM
you just did :D bump
Title: The Bumpy Thread
Post by: Flashy on April 12, 2011, 09:09:14 AM
So you can bump without knowing how to do so?
Title: The Bumpy Thread
Post by: jcj94 on April 12, 2011, 01:36:52 PM
Very bumping apparently so
Title: The Bumpy Thread
Post by: Freeza-CII on April 13, 2011, 07:06:30 AM
jus ttake your first bump slow instead of like other getting it done as fast as possible.
Title: The Bumpy Thread
Post by: jcj94 on April 13, 2011, 01:15:47 PM
Its just a jump to the left *jumps*
And then a step to the right! *taps right foot*
You put your hands on your hips *follows instructions*
and you bring you knees in tight *clamps knees*
You do the pelvic thrust
and then your going insane

LETS TO THE TIME WARP AGAIN!

... :P ... bump ... :P ...
Title: The Bumpy Thread
Post by: Freeza-CII on April 13, 2011, 04:25:42 PM
you have slightly redeemed yourself with rocky horror. bump

 
Title: The Bumpy Thread
Post by: jcj94 on April 13, 2011, 04:29:38 PM
Aww I thought Rocky Horror would redeem me for sure... :/  Lets see if I can come up with any movie references...


in the meantime BUMP
Title: The Bumpy Thread
Post by: CK9 on April 18, 2011, 10:40:51 AM
freeza with a chainsaw bump
Title: The Bumpy Thread
Post by: jcj94 on April 18, 2011, 03:34:09 PM
Me as my wolfy self BUMP
Title: The Bumpy Thread
Post by: Flashy on May 05, 2011, 07:51:01 AM
RPG bump
(Yes, rocket propelled grenade)
Title: The Bumpy Thread
Post by: jcj94 on May 05, 2011, 09:03:21 AM
Super eagle poop bump.
Title: The Bumpy Thread
Post by: CK9 on May 05, 2011, 11:04:06 AM
bump
Title: The Bumpy Thread
Post by: Freeza-CII on May 05, 2011, 01:27:34 PM
pistol grip bump
Title: The Bumpy Thread
Post by: CK9 on May 05, 2011, 09:31:08 PM
burning your bag melodramaticly and hoping I spelled everything right this time :P
Title: The Bumpy Thread
Post by: jcj94 on May 10, 2011, 07:32:36 AM
Super bump in order to debump the other thread (we all know what that is) that is competeing with the bumpy thread.

BUMPY THREAD 100 PAGES :D
Title: The Bumpy Thread
Post by: evecolonycamander on May 11, 2011, 04:15:47 PM
bump
Title: The Bumpy Thread
Post by: jcj94 on May 20, 2011, 11:43:11 AM
well bump you to ECC  :P
Title: The Bumpy Thread
Post by: Venera on May 20, 2011, 11:52:33 AM
thisisabump
Title: The Bumpy Thread
Post by: Flashy on May 20, 2011, 01:23:40 PM
Why do you bump a bumpy thread?
Title: The Bumpy Thread
Post by: Venera on May 20, 2011, 01:29:20 PM
becase you have the ability to BUMP
Title: The Bumpy Thread
Post by: evecolonycamander on May 20, 2011, 04:29:44 PM
because we love the idea of breaking rules without conciqince XD

badda BUMP


sorry bout spelling. im useing IE
Title: The Bumpy Thread
Post by: jcj94 on May 20, 2011, 06:17:11 PM
Quote
because we love the idea of breaking rules without conciqince XD

badda BUMP


sorry bout spelling. im useing IE
YOU DON'T BUMPING APOLOGIZE FOR SPELLING IN DAH BUMPA THREAD!

NOW ON your NEEZ SOLGIR
Title: The Bumpy Thread
Post by: evecolonycamander on May 20, 2011, 07:02:40 PM
dont correct me you fool. drop and give me 50. yeah, i said it. you now own me $50 usd. XD

like my pmub?


 
Title: The Bumpy Thread
Post by: Venera on May 21, 2011, 05:36:16 AM
bumping is bad for the soul.
Title: The Bumpy Thread
Post by: jcj94 on May 21, 2011, 08:04:52 PM
Quote
dont correct me you fool. drop and give me 50. yeah, i said it. you now own me $50 usd. XD

like my pmub?
I own you?  SWEET.  *pays 50 bucks with a Lego Convec, mailed to your address*

There you go, now though dos't oweth me 50 big ones.

BUMP
Title: The Bumpy Thread
Post by: Venera on May 21, 2011, 09:30:05 PM
Quote
bumping is bad for the soul.
^^^^
Title: The Bumpy Thread
Post by: jcj94 on May 22, 2011, 05:15:14 PM
Quote
Quote
bumping is bad for the soul.
^^^^
YOU CAN'T QUOTE YOUR BUMP... it just doesn't work like that.

 
Title: The Bumpy Thread
Post by: Venera on May 22, 2011, 06:22:41 PM
well it did. you replied

is this a bump? yes
Title: The Bumpy Thread
Post by: Flashy on May 23, 2011, 05:43:24 AM
Quote
Quote
Quote
bumping is bad for the soul.
^^^^
YOU CAN'T QUOTE YOUR BUMP... it just doesn't work like that.
That bump in "QUOTE YOUR BUMP" can count as bump, so that's not a quote-bump-post
Title: The Bumpy Thread
Post by: jcj94 on May 23, 2011, 07:09:59 AM
Quote
Quote
Quote
Quote
bumping is bad for the soul.
^^^^
YOU CAN'T QUOTE YOUR BUMP... it just doesn't work like that.
That bump in "QUOTE YOUR BUMP" can count as bump, so that's not a quote-bump-post
ITS A HALL OF MIRRORS :D

BUMP!!
Title: The Bumpy Thread
Post by: Venera on May 23, 2011, 12:14:31 PM
one day i was bumped which woke me up.  the cat had exploded so i  ran away only to find a magical flying pony. it went "BLAHHHHHH" and the world exploded but i was safe because I was on Pluto eating ice cream with Hades.  After that the pony came back and told me to fly away into the sun. The End.
Title: The Bumpy Thread
Post by: jcj94 on May 23, 2011, 03:43:39 PM
are you on crack? bump
 
Title: The Bumpy Thread
Post by: Lord Of Pain on May 23, 2011, 03:50:46 PM
Quote
Quote
Quote
Quote
Quote
bumping is bad for the soul.
^^^^
YOU CAN'T QUOTE YOUR BUMP... it just doesn't work like that.
That bump in "QUOTE YOUR BUMP" can count as bump, so that's not a quote-bump-post
ITS A HALL OF MIRRORS :D

BUMP!!
lol bumpy-mirror
Title: The Bumpy Thread
Post by: jcj94 on May 24, 2011, 11:30:38 AM
Quote
BUMP
Quote
BUMP
Quote
BUMP
Quote
BUMP
Quote
BUMP
Quote
BUMP
Quote
BUMP
Quote
BUMP
Quote
BUMP
Quote
BUMP
Quote
BUMP
Quote
BUMP
BUMP
Title: The Bumpy Thread
Post by: Venera on May 25, 2011, 04:07:11 AM
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
Title: The Bumpy Thread
Post by: Lord Of Pain on May 25, 2011, 06:33:22 AM
Alien: "You fool! your suppost to (bump) her!"

Snake: "Hell yea i'll (bump) her!"

Alien: *bumps her*

Snake: "WDF? you wrecked my car!!"

 
Title: The Bumpy Thread
Post by: Venera on May 25, 2011, 11:47:48 AM
explodaBUMP
Title: The Bumpy Thread
Post by: Lord Of Pain on May 25, 2011, 02:47:06 PM
you have done well our colony is bumping.
Title: The Bumpy Thread
Post by: Venera on May 25, 2011, 06:27:49 PM
Mission Objective: Bump your opponents.
Title: The Bumpy Thread
Post by: Lord Of Pain on May 26, 2011, 05:54:00 AM
Warning: Our bumpies are dying!
Title: The Bumpy Thread
Post by: Venera on May 26, 2011, 12:00:18 PM
New bumpie ready.
Title: The Bumpy Thread
Post by: Lord Of Pain on May 27, 2011, 06:02:39 AM
You have failed our colony has BUMPed.
Title: The Bumpy Thread
Post by: Venera on May 27, 2011, 11:50:47 AM
Reinforcements bumped.
Title: The Bumpy Thread
Post by: evecolonycamander on May 27, 2011, 03:08:52 PM
bump
Title: The Bumpy Thread
Post by: Venera on May 27, 2011, 07:15:06 PM
New mission bump.
Title: The Bumpy Thread
Post by: Lord Of Pain on May 28, 2011, 10:12:43 AM
hey is that BumpingMCbumpington? it is o.o!
Title: The Bumpy Thread
Post by: evecolonycamander on May 28, 2011, 09:09:50 PM
bump so lame its wicked awesome
Title: The Bumpy Thread
Post by: Lord Of Pain on May 29, 2011, 06:01:26 AM
Quote
Savant series computer activated.  Beginning alpha-command level briefing: for your eyes only.

Historical overview: humpton is dead.  As bumping fragments landed, the last few sirbumps departed humpington, seeking a new bumpington among bumptopia.

bump after unsuitable bump was rejected.  Their resources low, their situation bummed, a marginally suitable hump was found.

They called their new home bumpvillle.  It was cold.  Dry.  Nearly bumpy.  But they saw... Possibilities.  In that spirit of humping one another, they named their colony sirbump.  They came with the best of intentions: to build, grow, and thrive.  And for a time, they did.

Then, conflict arose between the sirbumps and a splinter colony, sirhumps, was founded.

bumpington would be their home, but on what terms?  sirhumps wished to live in harmony with bumpington, adapting themselves to live in its harsh realm, no matter the cost.

sirhump planned to tame its new bumps; to conquer it and hump it into a new bump using advanced obscene technology.

The two humpers could not co-exist.  Talks grew heated as sirhump learned sirbump's secret intention to proceed with humping.

In protest, sirhump destroyed the last bumptard link, condemning them to stop humping eachother.

Only one bumptopia, but two very different humpers.

Which will you hump?

wow i gotta take a moment and lmfao!!!!!
Title: The Bumpy Thread
Post by: Flashy on May 31, 2011, 08:07:50 AM
Are you now using silent bumps or what happened?
Title: The Bumpy Thread
Post by: Lord Of Pain on May 31, 2011, 10:51:16 AM
boy im so gonna hump my thump up your rump while bumping my car into yours :P
Title: The Bumpy Thread
Post by: Venera on May 31, 2011, 12:48:03 PM
should I be worried LOP? bump-a-cola
Title: The Bumpy Thread
Post by: evecolonycamander on May 31, 2011, 09:13:54 PM
worry. worry cause he still posts. worry cause may 21st was a ripoff; i spent the supposed last 6 hours of my life building a giant sand heart for my sweetheart(XD) just to find out ' im sorry, its oct pick-a-date.'
 so now im stuck trying to explain the new heart shaped beach 6 feet out into the water. bump.
Title: The Bumpy Thread
Post by: Flashy on June 02, 2011, 01:03:04 PM
What was that post about "Our bumps are dying"?
Title: The Bumpy Thread
Post by: Venera on June 02, 2011, 06:19:45 PM
bumper-nog
Title: The Bumpy Thread
Post by: evecolonycamander on June 03, 2011, 10:37:56 AM
im to lazy to come up with a bump in the sand(i was gonna make a 'bump' sand sculpture)
 
Title: The Bumpy Thread
Post by: Venera on June 03, 2011, 11:57:41 AM
bumpin-up
Title: The Bumpy Thread
Post by: jcj94 on June 04, 2011, 01:51:24 PM
sweet dreams are made of these who am I to disagree? travel the world and the 7 sees, everybody looking for something, some of them want to use you, some of them want to be used by use, some of them want to abuse you, some of them want to be abused....

BUMP
Title: The Bumpy Thread
Post by: Flashy on June 04, 2011, 02:08:48 PM
Keep bumping, there is still a lot of work needed for 100 pages of bumps
Title: The Bumpy Thread
Post by: Lord Of Pain on June 05, 2011, 12:34:05 PM
Quote
sweet dreams are made of these who am I to disagree? travel the world and the 7 sees, everybody looking for something, some of them want to use you, some of them want to be used by use, some of them want to abuse you, some of them want to be abused....

BUMP
sweet dreams are made of rumps who am I to hump? travel the world and the 7 bumps, everybody looking for bumpies , some of them want to hump you, some of them want to be humped by you...

lol ty jcj you gave me this idea for bumping XD
Title: The Bumpy Thread
Post by: Venera on June 05, 2011, 06:56:01 PM
Quick bump.
Title: The Bumpy Thread
Post by: jcj94 on June 05, 2011, 10:06:27 PM
Quote
Quote
sweet dreams are made of these who am I to disagree? travel the world and the 7 sees, everybody looking for something, some of them want to use you, some of them want to be used by use, some of them want to abuse you, some of them want to be abused....

BUMP
sweet dreams are made of rumps who am I to hump? travel the world and the 7 bumps, everybody looking for bumpies , some of them want to hump you, some of them want to be humped by you...

lol ty jcj you gave me this idea for bumping XD
i should rebump you, and bumport you.  no twisting that song... it is perfectly twisted by marylin manson :D
 
Title: The Bumpy Thread
Post by: Venera on June 06, 2011, 04:27:23 AM
Double-Bump root beer
Title: The Bumpy Thread
Post by: evecolonycamander on June 07, 2011, 04:35:23 PM
why was this thread even started? dosn't matter, we bump it anyways
Title: The Bumpy Thread
Post by: Venera on June 07, 2011, 06:02:18 PM
Deadbump Draquiri
Title: The Bumpy Thread
Post by: Lord Of Pain on June 08, 2011, 10:56:57 AM
bite me!!

..

errr...

 i mean bump me!!
Title: The Bumpy Thread
Post by: evecolonycamander on June 08, 2011, 03:57:40 PM
lop, did you even read what you wrote? it sounded bumping bumpiliy
Title: The Bumpy Thread
Post by: Venera on June 08, 2011, 07:46:02 PM
bump
Title: The Bumpy Thread
Post by: Lord Of Pain on June 09, 2011, 08:14:32 AM
subbed you need to post serious bumps if you want to race in this race.
Otherwise you cant race in this race.... a child couldent race in this race..... You need to aaaah ooooh aaaaah!! if you want to race in this race.... you dont even have what it takes if you want to race in this race.
now byte my dust!!!!! *vvrrrruuuummm*
Title: The Bumpy Thread
Post by: Venera on June 09, 2011, 09:02:30 PM
this bump is serious.  
Title: The Bumpy Thread
Post by: evecolonycamander on June 11, 2011, 08:49:48 AM
-... ..- -- .--.
Title: The Bumpy Thread
Post by: Venera on June 11, 2011, 09:21:31 AM
bump
Title: The Bumpy Thread
Post by: evecolonycamander on June 11, 2011, 09:33:34 PM
1110101010001010111000111011100010111011101
 
Title: The Bumpy Thread
Post by: Venera on June 12, 2011, 06:10:50 AM
bump
Title: The Bumpy Thread
Post by: Flashy on June 12, 2011, 01:26:06 PM
There are 7 pages of bumps since I mentioned 50 pages of bumps.
Title: The Bumpy Thread
Post by: Venera on June 12, 2011, 02:19:49 PM
Bump's X2 RayGun
Title: The Bumpy Thread
Post by: Lord Of Pain on June 12, 2011, 04:37:23 PM
need i say more? (http://www.youtube.com/watch?v=O9Jp3w8Z10s)
Title: The Bumpy Thread
Post by: Venera on June 13, 2011, 05:30:31 AM
Quote
need i say more? (http://www.youtube.com/watch?v=O9Jp3w8Z10s)
no comment....

bump
Title: The Bumpy Thread
Post by: Lord Of Pain on June 13, 2011, 07:47:16 AM
(http://forums.trinituner.com/upload/data/3c/Im_Here_To_Bump_This_Thread_Try_And.jpg)
Title: The Bumpy Thread
Post by: Venera on June 13, 2011, 10:29:51 AM
Bump of duty: Modern Bumpware 2
Title: The Bumpy Thread
Post by: Venera on June 14, 2011, 08:15:40 AM
Pokemon Rangers: Bumpy signs.
Title: The Bumpy Thread
Post by: CK9 on June 30, 2011, 09:34:16 AM
bump the bumping bumpers
Title: The Bumpy Thread
Post by: Flashy on June 30, 2011, 10:13:54 AM
That bump was overdue
Title: The Bumpy Thread
Post by: Venera on June 30, 2011, 08:23:38 PM
bump

nice to see someone replying again :P
Title: The Bumpy Thread
Post by: jcj94 on July 04, 2011, 05:45:11 PM
BUMPITY BUMPING BUMP :D  I"M BACK AND BUMPING BUMPERS!
Title: The Bumpy Thread
Post by: Flashy on July 05, 2011, 04:26:09 AM
Just keep bumping there is a long way to go
Title: The Bumpy Thread
Post by: jcj94 on July 05, 2011, 07:06:20 PM
BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP BUMP NOBUMP BUMP
Title: The Bumpy Thread
Post by: Freeza-CII on July 06, 2011, 07:06:53 AM
"/bump"
Title: The Bumpy Thread
Post by: Flashy on July 11, 2011, 01:16:57 PM
If no one forgets to bump this thread we will be on page 100.
Title: The Bumpy Thread
Post by: Venera on July 11, 2011, 02:20:15 PM
TethysGame::CreateUnit(x, mapBUMP, LOCATION(this+32, thread-1), mapBUMPY, 1);

There are mostlikely errors in that code.
Title: The Bumpy Thread
Post by: Flashy on July 12, 2011, 01:30:40 AM
Code: [Select]
enum map_id {
 mapBUMP = 0x7,
 mapBUMPY = 0x48
}
No more
(As long as you define those integer variables)
Title: The Bumpy Thread
Post by: jcj94 on July 13, 2011, 05:34:57 PM
THE BUMPY MAP...


we should totally do that xDDD

/me opens up his OP2Mapper and writes BUMP on a map, making all terrain sand vs volcanic flows
Title: The Bumpy Thread
Post by: Lord Of Pain on July 14, 2011, 05:21:14 PM
brump-ah-bump-bump, hear my drums :)
Title: The Bumpy Thread
Post by: Flashy on July 15, 2011, 05:39:22 AM
-1P, Bmp, 'Bumpy map'
Title: The Bumpy Thread
Post by: Spikerocks101 on July 15, 2011, 06:41:11 AM
Hipster Bumper says: I was bumping before bumping was cool.
Title: The Bumpy Thread
Post by: Venera on July 15, 2011, 07:47:23 AM
Code: [Select]
<?php
if (isset($_GET['do'])) {
  if ($_GET['do'] == "bump") {
    $array = array("BUMP","BUMPY","BUMPY3","BLEH");
    $value = $_POST['bump'];
    if (in_array($value,$array)) {
      echo "BUMP";
    }
  }
}
?>
<html>
<body>
<form action="http://forum.outpost2.net/index.php?showtopic=1427&st=1368&do=bump" method="GET">
<input type="text" name="bump" /><input type="submit" value="bump" />
</body>
</html>
Title: The Bumpy Thread
Post by: Flashy on July 15, 2011, 11:45:42 AM
That's a complex bump
Title: The Bumpy Thread
Post by: CK9 on July 15, 2011, 01:03:52 PM
I've been bumping wondering who this Tethy is in relation to the game code...
Title: The Bumpy Thread
Post by: Hooman on July 16, 2011, 05:02:30 PM
I believe the most bumping likely answer is this:
Tethys (moon) (http://en.wikipedia.org/wiki/Tethys_(moon))
Title: The Bumpy Thread
Post by: Freeza-CII on July 17, 2011, 09:56:35 AM
http://outpostuniverse.net/~freeza/images/BUMP.JPG (http://outpostuniverse.net/~freeza/images/BUMP.JPG)
its been bump
Title: The Bumpy Thread
Post by: evecolonycamander on July 19, 2011, 07:17:16 AM
back to bumping
Title: The Bumpy Thread
Post by: jcj94 on July 19, 2011, 06:12:03 PM
BUMPING 58 PAGES... LETS DO 58 MORE!
Title: The Bumpy Thread
Post by: Hidiot on July 19, 2011, 11:44:51 PM
The bump goal was 100 pages. Better get there first before planning to go further.
Title: The Bumpy Thread
Post by: Flashy on July 20, 2011, 04:41:37 AM
after bumping page 100, we can go for 1000 bump pages
Title: The Bumpy Thread
Post by: jcj94 on July 20, 2011, 06:13:03 PM
Quote
after bumping page 100, we can go for 1000 bump pages
oh BUMP yes!
Title: The Bumpy Thread
Post by: evecolonycamander on July 21, 2011, 07:06:18 AM
Refer to:
http://forum.outpost2.net/index.php?showto...=48&#entry76951 (http://forum.outpost2.net/index.php?showtopic=5256&st=48&#entry76951)
Title: The Bumpy Thread
Post by: Flashy on July 22, 2011, 10:48:08 AM
At least there are 1384 replies. Mind the bump.
Title: The Bumpy Thread
Post by: evecolonycamander on July 22, 2011, 12:01:20 PM
BUMP
Title: The Bumpy Thread
Post by: jcj94 on July 23, 2011, 12:42:35 PM
BUMPING BUMPITY BUMPEROOO
Title: The Bumpy Thread
Post by: Flashy on July 23, 2011, 12:53:35 PM
Those are the bumps we need.
Title: The Bumpy Thread
Post by: evecolonycamander on July 23, 2011, 02:47:58 PM
acdefghijklmnoqrstvwxyz
Title: The Bumpy Thread
Post by: jcj94 on July 23, 2011, 04:18:24 PM
NO INVERTED BUMPING YOU BORON

(note: That sounded a lot cooler in my head...)
Title: The Bumpy Thread
Post by: evecolonycamander on July 25, 2011, 07:52:40 AM
pmubump
Title: The Bumpy Thread
Post by: Flashy on July 25, 2011, 08:24:49 AM
You shall bump.
Title: The Bumpy Thread
Post by: evecolonycamander on July 25, 2011, 09:56:47 AM
to bump, or not to bump?
that is the question - parody of most quoted Shakespeare line
Title: The Bumpy Thread
Post by: Flashy on July 25, 2011, 10:52:41 AM
Quote
to bump, or not to bump?
that is the question - parody of most quoted Shakespeare line
Answer is to bump.
Title: The Bumpy Thread
Post by: Venera on July 27, 2011, 10:08:01 AM
Bump[/size][/font]
Title: The Bumpy Thread
Post by: Flashy on July 27, 2011, 04:00:46 PM
Exactly that bump.
Title: The Bumpy Thread
Post by: Venera on July 27, 2011, 07:31:24 PM
I got a laptop cord! I can play op2!  But I need to "relearn" how.

bump.
Title: The Bumpy Thread
Post by: Lord Of Pain on July 29, 2011, 09:40:40 AM
(http://www.danhdesigns.com/Real%20Road%20Signs%20PHP/y_rrs_bump.png)
Title: The Bumpy Thread
Post by: Flashy on August 01, 2011, 03:53:32 AM
I'd say I can't quote that bump.
Title: The Bumpy Thread
Post by: Lord Of Pain on August 01, 2011, 10:01:44 AM
(http://ec1.images-amazon.com/images/I/51JjheoUb7L._AA240_.jpg)

your all going to have to do better than just plain text as my leet eyecandy overflows this thread :P

Cmon lets see some pics for this thread already!
Title: The Bumpy Thread
Post by: jcj94 on August 01, 2011, 11:57:02 AM
Living Dead Girl
Rob Zombie


Find the REAL bump ;)
Title: The Bumpy Thread
Post by: Venera on August 02, 2011, 06:32:52 PM
never judge a book by it's bump.
Title: The Bumpy Thread
Post by: evecolonycamander on August 02, 2011, 10:30:07 PM
'find the real bump
set, match, game XD




as on the great log
like twenty large water toads
you bump on a log
Title: The Bumpy Thread
Post by: Lord Of Pain on August 03, 2011, 08:30:49 AM
(http://members.ij.net/captbob2112/bumping.JPG)

kids never attempt this at home XD
Title: The Bumpy Thread
Post by: Flashy on August 04, 2011, 10:32:42 AM
travel-bump
Title: The Bumpy Thread
Post by: jcj94 on August 07, 2011, 11:43:30 AM
Family war-fare bump
Title: The Bumpy Thread
Post by: Flashy on August 07, 2011, 12:27:59 PM
usr posted image-bump
Title: The Bumpy Thread
Post by: evecolonycamander on August 10, 2011, 07:20:39 AM
The missing eleventh and twelfth commandment:


XI: Thou shalt bump the outpost universe bump thread often
XII: Thou shalt cherish thy Outpost 2 video game copy
Title: The Bumpy Thread
Post by: Flashy on August 10, 2011, 08:47:17 AM
bump indeed
Title: The Bumpy Thread
Post by: Venera on August 10, 2011, 07:12:14 PM
iBumpbot.
Title: The Bumpy Thread
Post by: jcj94 on August 11, 2011, 11:27:06 AM
iBump uBump 1Bump 2Bump :D

Roses are red,
Violets are blue
I'm a bumpaholic
and so are you :)
Title: The Bumpy Thread
Post by: Flashy on August 11, 2011, 02:25:15 PM
E=Bump²
Title: The Bumpy Thread
Post by: Venera on August 11, 2011, 08:08:13 PM
The Bumptrix.  The Matrix: Rebumped.  The Matrix: Revolutiobumps.
Title: The Bumpy Thread
Post by: Flashy on August 13, 2011, 05:45:21 AM
plain and simple bump
Title: The Bumpy Thread
Post by: Venera on August 17, 2011, 04:35:35 AM
bump
Title: The Bumpy Thread
Post by: Flashy on August 18, 2011, 01:07:23 AM
Quote
bump
Do I need to say more?
Title: The Bumpy Thread
Post by: Venera on August 21, 2011, 07:21:17 PM
Depends on what needs to be said.

bump
Title: The Bumpy Thread
Post by: evecolonycamander on August 22, 2011, 12:12:02 PM
BuMpY bump
Title: The Bumpy Thread
Post by: Savant_Ace on August 22, 2011, 12:21:06 PM
ThuBUMP. (What?)
Title: The Bumpy Thread
Post by: Flashy on August 22, 2011, 12:36:46 PM
mp
bu
Title: The Bumpy Thread
Post by: Savant_Ace on August 22, 2011, 01:35:37 PM
umpBay?
Title: The Bumpy Thread
Post by: Venera on August 22, 2011, 05:00:31 PM
8c6b0ae4ba3cb4d4716e166d1c1540f0

MD5 Hash
Title: The Bumpy Thread
Post by: Flashy on August 23, 2011, 01:59:42 AM
42 75 6d 70

Hex
Title: The Bumpy Thread
Post by: Savant_Ace on August 23, 2011, 07:30:59 AM
552913 (Base 36)
Title: The Bumpy Thread
Post by: Venera on August 23, 2011, 04:31:42 PM
01100010011101010110110101110000

Base 2 (Binary)
Title: The Bumpy Thread
Post by: Spikerocks101 on August 24, 2011, 08:09:37 AM
╨ª↓á▒| (no base... not even sure if it means bump... i just slammed my head against the keyboard while holding alt)
Title: The Bumpy Thread
Post by: Savant_Ace on August 24, 2011, 09:30:27 AM
Hahahahaha

BUMP + 1 = 10 (Base BUMP)
Title: The Bumpy Thread
Post by: evecolonycamander on August 24, 2011, 05:03:39 PM
Bump
Title: The Bumpy Thread
Post by: Venera on August 25, 2011, 04:37:24 AM
100101020221122120112011

Guess the base.
Title: The Bumpy Thread
Post by: Savant_Ace on August 26, 2011, 12:30:46 PM
Potatobump!
Title: The Bumpy Thread
Post by: Venera on August 27, 2011, 07:33:02 AM
Windows 7: Bumpy Edition.
Title: The Bumpy Thread
Post by: Savant_Ace on August 27, 2011, 08:55:39 PM
Theres another edition of windoze? (bump)
Title: The Bumpy Thread
Post by: Flashy on August 28, 2011, 04:42:28 AM
winbump
Title: The Bumpy Thread
Post by: Savant_Ace on August 28, 2011, 05:48:01 AM
Losebump!
Title: The Bumpy Thread
Post by: Spikerocks101 on August 28, 2011, 10:09:04 AM
Didn'tQuiteLoseButCameInSecondSoYouDidn'tWinEitherBump
Title: The Bumpy Thread
Post by: Savant_Ace on August 28, 2011, 12:12:37 PM
AsOfThisPostQuiteLostBump
Title: The Bumpy Thread
Post by: Venera on August 28, 2011, 06:43:51 PM
Mac OS X 10.3 Bumper
Title: The Bumpy Thread
Post by: Savant_Ace on August 28, 2011, 06:46:36 PM
Which is about as useful as a bumper sticker.
Title: The Bumpy Thread
Post by: evecolonycamander on August 29, 2011, 04:45:19 AM
how is this game fun? i been bumping away and still dont see the fun. i just want to see it hit 100 pages
Title: The Bumpy Thread
Post by: Flashy on August 29, 2011, 06:20:55 AM
Well, 60 pages of bumps show progress.
Title: The Bumpy Thread
Post by: Savant_Ace on August 29, 2011, 08:03:41 AM
Progress in what? Everyone having way the frag too much spare time for bumping?
Title: The Bumpy Thread
Post by: evecolonycamander on August 29, 2011, 10:10:46 AM
61 pages.. wow. lol, in about 8 pages after this... hahaah,
bump
Title: The Bumpy Thread
Post by: Savant_Ace on August 29, 2011, 09:16:01 PM
The Blight is bumping!
Title: The Bumpy Thread
Post by: evecolonycamander on August 30, 2011, 03:13:33 AM
single most lame pump ever! < ----------------
Title: The Bumpy Thread
Post by: Savant_Ace on August 30, 2011, 05:59:09 AM
Epicly BuMpInG!
Title: The Bumpy Thread
Post by: Flashy on September 01, 2011, 05:06:00 PM
bump
Title: The Bumpy Thread
Post by: Savant_Ace on September 02, 2011, 07:38:49 AM
The BuMp is approaching!
Title: The Bumpy Thread
Post by: Venera on September 03, 2011, 02:24:36 PM
Marching Bumps
Title: The Bumpy Thread
Post by: Savant_Ace on September 04, 2011, 08:53:30 PM
Goose Bumps?
 
Title: The Bumpy Thread
Post by: Flashy on September 08, 2011, 09:10:11 AM
bump
Did I run out of ideas
Title: The Bumpy Thread
Post by: Galactic on September 08, 2011, 11:55:51 AM
Bump in the road
Title: The Bumpy Thread
Post by: CK9 on September 09, 2011, 12:33:36 PM
It's amazing how bumping long this thread has lived
Title: The Bumpy Thread
Post by: Flashy on September 09, 2011, 03:12:50 PM
fascination with bumping
Title: The Bumpy Thread
Post by: Savant_Ace on September 10, 2011, 09:15:07 AM
The Bump! The Bump! The Bump is on fire!
Title: The Bumpy Thread
Post by: Flashy on September 10, 2011, 09:26:06 AM
I wonder if really every post in here has a bump (hidden or not)
Title: The Bumpy Thread
Post by: Hidiot on September 10, 2011, 01:43:10 PM
Take it upon yourself to check that.

bump
Title: The Bumpy Thread
Post by: evecolonycamander on September 11, 2011, 10:40:38 PM
Quote
Take it upon yourself to check that.

bump
lol, nice bump
Title: The Bumpy Thread
Post by: Savant_Ace on September 12, 2011, 08:40:09 AM
And in this corner, the undefeated! The undefinable! The ever-repetative, BUMP!
Title: The Bumpy Thread
Post by: evecolonycamander on September 13, 2011, 11:10:02 PM
Lol, just realized savant_ace is member 404. bump
i hate that 404 error
Title: The Bumpy Thread
Post by: Savant_Ace on September 15, 2011, 01:29:30 PM
Hehehe you should see my profile. I maintained tradition when I bumped this site.
Title: The Bumpy Thread
Post by: Flashy on September 18, 2011, 10:42:01 AM
Takes time to bump
Title: The Bumpy Thread
Post by: evecolonycamander on September 18, 2011, 09:18:49 PM
then bumping bump or i'll bumping kill you with a speed bump. and a car.
Title: The Bumpy Thread
Post by: Savant_Ace on September 19, 2011, 07:37:42 AM
Sounds like a painful way to bump.
Title: The Bumpy Thread
Post by: Lord Of Pain on September 19, 2011, 04:08:08 PM
i leave for a few months look what happens; nobody bumped another pic! must i be the only one?

(http://1.bp.blogspot.com/_0UspntJS0QU/R2v2qRkmLHI/AAAAAAAAA5o/dvq9nNI1utU/s400/bio_photo2.jpg)

cmon i want to see more interesting bumps, with eye candy! stop giving me a headache with these lame bumps XD
Title: The Bumpy Thread
Post by: evecolonycamander on September 20, 2011, 02:44:49 AM
(http://www.treehugger.com/Swedish-For-Speed-Bump.jpg)
apparently it translates to 'speed bump'(Swedish to English)
Title: The Bumpy Thread
Post by: Savant_Ace on September 20, 2011, 09:35:15 AM
Oh the bumpy places I could go with that one...
Title: The Bumpy Thread
Post by: evecolonycamander on September 21, 2011, 03:55:36 PM
☻☻☻☻☻☻☻☻☻☻☻☻☻☻☻☻☻☻☻☻
☻☺☺☻☻☺☻☻☺☻☺☺☻☺☺☻☺☺☻☻
☻☺☻☺☻☺☻☻☺☻☺☻☺☻☺☻☺☻☺☻
☻☺☺☻☻☺☻☻☺☻☺☻☻☻☺☻☺☺☻☻
☻☺☻☺☻☺☻☻☺☻☺☻☻☻☺☻☺☻☻☻
☻☺☺☻☻☻☺☺☻☻☺☻☻☻☺☻☺☻☻☻
☻☻☻☻☻☻☻☻☻☻☻☻☻☻☻☻☻☻☻☻
Title: The Bumpy Thread
Post by: Savant_Ace on September 22, 2011, 08:56:36 AM
The first time I read that bump I thought it said 'DUMP'. I was very confused for a short period.
Title: The Bumpy Thread
Post by: evecolonycamander on September 22, 2011, 09:54:17 PM
Confusion was my goal. glad to see it was met.
(http://www.freecodesource.com/album-cover/51jadN6raaL/Bump-of-Chicken-Mayday.jpg)
Title: The Bumpy Thread
Post by: Venera on September 24, 2011, 05:15:09 AM
Quote
bump
Title: The Bumpy Thread
Post by: Savant_Ace on September 25, 2011, 07:34:34 PM
My friend had a bump once. I reccomended he get it looked at by a doctor.
Title: The Bumpy Thread
Post by: Venera on September 29, 2011, 05:33:39 AM
bump
Title: The Bumpy Thread
Post by: evecolonycamander on September 29, 2011, 09:01:08 AM
Badda-bump
Title: The Bumpy Thread
Post by: Savant_Ace on September 30, 2011, 08:51:32 AM
Bite my shiny metal BUMP!
Title: The Bumpy Thread
Post by: evecolonycamander on September 30, 2011, 10:15:37 AM
futurama bump?
Title: The Bumpy Thread
Post by: Venera on October 01, 2011, 05:09:02 AM
b
u
m
p
Title: The Bumpy Thread
Post by: Lord Of Pain on October 01, 2011, 06:29:31 AM
bump you in the nether :P

( EDIT: that better?)
Title: The Bumpy Thread
Post by: Hidiot on October 01, 2011, 03:23:48 PM
LoP, by this point, you could be accused of advertising. You should stop bumping your random links everywhere and keep them in one place and one place only: The Spam section.
Title: The Bumpy Thread
Post by: Savant_Ace on October 03, 2011, 01:52:55 PM
Its gonna be fun on a bump!!
 
Title: The Bumpy Thread
Post by: Venera on October 08, 2011, 05:52:05 AM
Bump
Title: The Bumpy Thread
Post by: evecolonycamander on October 08, 2011, 08:18:35 AM
bbbbbbbbbbbbbbbbbbbbbbbbbbbbuuuuuuuuuuuuuuuuuuuuuuuuuuuummmmmmmmmmmmmmmmmmmmmmmmmmmmpppppppppppppppppppppppp
Title: The Bumpy Thread
Post by: Venera on October 09, 2011, 05:24:21 AM
Quote
bbbbbbbbbbbbbbbbbbbbbbbbbbbbuuuuuuuuuuuuuuuuuuuuuuuuuuuummmmmmmmmmmmmmmmmmmmmmmmmmmmpppppppppppppppppppppppp
bumpy quote
Title: The Bumpy Thread
Post by: Savant_Ace on October 19, 2011, 06:01:05 AM
This has been one long bump...
Title: The Bumpy Thread
Post by: evecolonycamander on October 20, 2011, 01:02:30 AM
Wonder if minecraft will every get an op2 mod? that would be bumping awesome... or total crap. XD
Title: The Bumpy Thread
Post by: Venera on October 20, 2011, 04:26:49 AM
http://www.outpost2.bump (http://www.outpost2.bump)
Title: The Bumpy Thread
Post by: Savant_Ace on October 20, 2011, 10:41:13 PM
Hmm, my colonists are bumping on New Terra...
Title: The Bumpy Thread
Post by: CK9 on October 20, 2011, 10:52:16 PM
Irratibility bump

Of all the maps I had, the only ones to have survived my laptop's misbehavior were 2 completed maps for bomber, my cliff pallet, and an experimental map that, while small, is very difficult to complete by the nature of the tiles being used.  I lost my volcano race map that was 50% complete after over a month of work -.-
Title: The Bumpy Thread
Post by: evecolonycamander on October 22, 2011, 01:16:59 AM
Back ups might please
Title: The Bumpy Thread
Post by: CK9 on October 22, 2011, 10:47:24 AM
oh yea...maybe they survived on one of my flash drives...

p
Title: The Bumpy Thread
Post by: Venera on October 22, 2011, 08:43:37 PM
Quote
Back ups might please
lol

bump
Title: The Bumpy Thread
Post by: evecolonycamander on October 23, 2011, 02:33:55 AM
Quote
Quote
Back ups might please
lol

bump
Tbh, that bump was by mistake.
Title: The Bumpy Thread
Post by: CK9 on October 23, 2011, 10:08:32 AM
bump
Title: The Bumpy Thread
Post by: Savant_Ace on October 24, 2011, 08:23:22 AM
"Its been a long bump, gettin' from there to here.."
Title: The Bumpy Thread
Post by: CK9 on October 24, 2011, 08:59:21 AM
'cause I've got bump of the heart, noone's gonna bend or break me...
Title: The Bumpy Thread
Post by: evecolonycamander on October 24, 2011, 09:23:08 AM
Has this forum ever been HEAVILY active? and if so, how did you all manage?
bump
Title: The Bumpy Thread
Post by: CK9 on October 24, 2011, 12:32:07 PM
This itteration of the bump has never been heavily active, however there was a previous bump that was.  We were all younger then.
Title: The Bumpy Thread
Post by: Venera on October 24, 2011, 06:50:45 PM
I play cymbals in my school's Bumpline.
Title: The Bumpy Thread
Post by: Savant_Ace on October 26, 2011, 09:26:32 AM
A mistake at this point will lead you and your colonists to certian bump. Have a nice day.
Title: The Bumpy Thread
Post by: CK9 on October 26, 2011, 09:52:20 AM
dead bump, dead bump, just another dead bump
Title: The Bumpy Thread
Post by: Savant_Ace on October 26, 2011, 10:51:42 AM
To boldly go where no bump has gone before!
Title: The Bumpy Thread
Post by: CK9 on October 26, 2011, 10:47:42 PM
vyno

can you explain that bump?
Title: The Bumpy Thread
Post by: Savant_Ace on October 27, 2011, 06:47:48 AM
Klateau Verata BUMPteau!
Title: The Bumpy Thread
Post by: Spikerocks101 on October 27, 2011, 06:59:28 AM
Bump
Title: The Bumpy Thread
Post by: CK9 on October 29, 2011, 11:29:54 AM
buuuuuuuuuuuuuuuuuuuuuurrrrrrrrrrrrp!

exbumpse me
Title: The Bumpy Thread
Post by: Savant_Ace on October 31, 2011, 08:20:01 AM
Only one bump left to go.
One bump left to see.
Cause' when all the bumps end,
The only bump left is me.
Title: The Bumpy Thread
Post by: CK9 on October 31, 2011, 07:29:39 PM
it's just a bump to the left, and then a bump to the right, put your hands on your hips...
Title: The Bumpy Thread
Post by: Spikerocks101 on October 31, 2011, 09:14:10 PM
LETS DO THE BUMP WARP AGAIN!!!!!!!
Title: The Bumpy Thread
Post by: Savant_Ace on November 01, 2011, 05:39:39 AM
You people and your transvestbump dances.
Title: The Bumpy Thread
Post by: plymoth45 on November 01, 2011, 07:36:17 AM
Didn't the bump have hundreds of pages once? Or am I bumping wrong?
Title: The Bumpy Thread
Post by: CK9 on November 01, 2011, 01:36:33 PM
hun dreds of bumps, plym, and great to see you again =)
Title: The Bumpy Thread
Post by: Spikerocks101 on November 01, 2011, 03:15:21 PM
b is for brains, which zombies want to eat
u is for unicorns, which have horns and wings
m is for meteors, which destroy my base
p is for plymouth45, which is nice to see you again
Title: The Bumpy Thread
Post by: plymoth45 on November 01, 2011, 05:03:28 PM
Yup, ole Plymy is going active again briefly. All for the bump!
Title: The Bumpy Thread
Post by: CK9 on November 01, 2011, 09:21:54 PM
we're just a bunch of bumping bumpers
Title: The Bumpy Thread
Post by: Savant_Ace on November 02, 2011, 09:11:49 AM
He's bumping again for all the wrong reasons. Live for the OPU, bump for the joy.
Title: The Bumpy Thread
Post by: plymoth45 on November 02, 2011, 12:02:08 PM
bump for the joy? Or bump just to bump?
Title: The Bumpy Thread
Post by: CK9 on November 03, 2011, 09:11:39 AM
to bump or not to bump, that is the question...
Title: The Bumpy Thread
Post by: plymoth45 on November 03, 2011, 12:09:41 PM
Least theres some of us who still bump
Title: The Bumpy Thread
Post by: jcj94 on November 03, 2011, 03:42:02 PM
how2bump3?
Title: The Bumpy Thread
Post by: CK9 on November 03, 2011, 03:55:40 PM
bump
Title: The Bumpy Thread
Post by: jcj94 on November 03, 2011, 04:26:07 PM
Quote
bump
bump  BUUMMMPPPP
bump  BBBBUUUMMP
Title: The Bumpy Thread
Post by: plymoth45 on November 03, 2011, 04:55:58 PM
big bump, little bump, sideways bump, bump bump bump
Title: The Bumpy Thread
Post by: Spikerocks101 on November 03, 2011, 10:20:05 PM
North bump
Title: The Bumpy Thread
Post by: Lord Of Pain on November 04, 2011, 08:16:28 AM
Bump You Hard!! :P
Title: The Bumpy Thread
Post by: CK9 on November 04, 2011, 09:19:08 AM
Bnwb

flip it upside down and it almost looks russian, lol
Title: The Bumpy Thread
Post by: plymoth45 on November 04, 2011, 11:19:20 AM
Nice bump ck, hadn't thought of that one lol
Title: The Bumpy Thread
Post by: evecolonycamander on November 04, 2011, 11:25:57 AM
Quote
Bump
Quote
Bump
Quote
Bump
Quote
Bump
Quote
Bump
Quote
Bump
Quote
Bump
Quote
Bump
Quote
Bump
Quote
Bump
Quote
Bump
Quote
Bump
the bump tree
Title: The Bumpy Thread
Post by: plymoth45 on November 04, 2011, 11:30:44 AM
Eh, I've seen that bump before :P
Title: The Bumpy Thread
Post by: jcj94 on November 04, 2011, 06:49:26 PM
HAH bump ECC!! bump YOU bump STOLE bump MY bump BUMP!
Title: The Bumpy Thread
Post by: CK9 on November 04, 2011, 07:11:06 PM
bump
Title: The Bumpy Thread
Post by: jcj94 on November 05, 2011, 06:09:13 AM
Quote
bump
suchablandbump
Title: The Bumpy Thread
Post by: plymoth45 on November 05, 2011, 07:15:49 AM
Quote
Quote
bump
suchablandbump
Such a called out bump
Title: The Bumpy Thread
Post by: jcj94 on November 05, 2011, 08:23:27 AM
Quote
Quote
Quote
bump
suchablandbump
Such a called out bump
another bump that starts with 'such a' bump.

D: it broke the bumpcle DDD:
Title: The Bumpy Thread
Post by: Lord Of Pain on November 05, 2011, 08:38:54 AM
Quote
Quote
Quote
Quote
bump
suchablandbump
Such a called out bump
another bump that starts with 'such a' bump.

D: it broke the bumpcle DDD:
i hate the bumpits, mostly that frog and the pig... i swear that pig is after kermit's bumpers.
Title: The Bumpy Thread
Post by: plymoth45 on November 05, 2011, 11:04:35 AM
Quote
Quote
Quote
Quote
Quote
bump
suchablandbump
Such a called out bump
another bump that starts with 'such a' bump.

D: it broke the bumpcle DDD:
i hate the bumpits, mostly that frog and the pig... i swear that pig is after kermit's bumpers.
I think you're bumping right...
Title: The Bumpy Thread
Post by: jcj94 on November 05, 2011, 11:18:57 AM
bumpity bump bump ba bump bo.
Title: The Bumpy Thread
Post by: Venera on November 05, 2011, 08:02:54 PM
Anyway way you bump it.
Title: The Bumpy Thread
Post by: jcj94 on November 05, 2011, 08:17:44 PM
Quote
Anyway way you bump it.
thats the way you bump it.
Title: The Bumpy Thread
Post by: CK9 on November 05, 2011, 10:47:34 PM
whatever bumps your boat...
Title: The Bumpy Thread
Post by: plymoth45 on November 06, 2011, 07:32:59 AM
ck, I bumped your boat...
Title: The Bumpy Thread
Post by: CK9 on November 06, 2011, 10:01:56 AM
well, are you ever going to bumping fix your images?
Title: The Bumpy Thread
Post by: plymoth45 on November 06, 2011, 07:28:13 PM
I haven't bumping thought about it yet, I don't own that bumping domain anymore lol
Title: The Bumpy Thread
Post by: CK9 on November 07, 2011, 01:15:39 AM
unless I'm misbumpen, you can upload directly to the forum for your avatar...and then there's this for your sig:
http://gallery.outpostuniverse.net/ (http://gallery.outpostuniverse.net/)
Title: The Bumpy Thread
Post by: Venera on November 08, 2011, 05:11:03 PM
Don't stop bumping.

I'm doing song names from the journey show at my highschool for the half-time show.

Anyway you bump it = Anyway you want it.
Title: The Bumpy Thread
Post by: plymoth45 on November 09, 2011, 06:50:06 PM
I don't own any of my bumping sigs anymore. They're all on my old desktop which is in Oklahoma on an old EIDE hdd that I don't have a caddy for :( I also don't have photoshop anymore :'(
Title: The Bumpy Thread
Post by: Venera on November 09, 2011, 09:26:13 PM
Seperate bumps.
Title: The Bumpy Thread
Post by: CK9 on November 10, 2011, 10:33:31 AM
that bumping sucks plym...we'll just have to make you a new one...
Title: The Bumpy Thread
Post by: Venera on November 10, 2011, 01:48:12 PM
Bumpily.
Title: The Bumpy Thread
Post by: evecolonycamander on November 10, 2011, 10:55:48 PM
Bump
Title: The Bumpy Thread
Post by: Venera on November 11, 2011, 06:08:15 AM
carol of the bumps.
Title: The Bumpy Thread
Post by: plymoth45 on November 13, 2011, 04:31:20 PM
I have another 4 bumps... I mean months... before I have the ability to do anything in that fasion lol
Title: The Bumpy Thread
Post by: Venera on November 13, 2011, 06:00:37 PM
OP2Bumper.
Title: The Bumpy Thread
Post by: CK9 on November 13, 2011, 09:32:15 PM
bump
Title: The Bumpy Thread
Post by: Venera on November 14, 2011, 05:12:09 AM
bump
Title: The Bumpy Thread
Post by: CK9 on November 14, 2011, 11:39:06 AM
bump
Title: The Bumpy Thread
Post by: Venera on November 14, 2011, 01:42:54 PM
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
bumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbumpbump
 
Title: The Bumpy Thread
Post by: plymoth45 on November 14, 2011, 03:04:02 PM
pmubump
Title: The Bumpy Thread
Post by: Venera on November 14, 2011, 05:38:40 PM
bump
Title: The Bumpy Thread
Post by: CK9 on November 14, 2011, 08:12:58 PM
Code: [Select]
111111111111111111111111111111111111111111111111111111111111111
110000000111111000111000111100000111000001111000000011111100011
110000000001111000111000111100000111000001111000000000111100011
110001110001111000111000111100000010000001111000111000111100011
110001110001111000111000111100000000000001111000111000111100011
110000000111111000111000111100010000010001111000000011111100011
110000000111111000111000111100010000010001111000000111111100011
110001110001111000111000111100011000110001111000111111111100011
110001110001111000010000111100011101110001111000111111111111111
110000000001111100000000111100011111110001111000111111111100011
110000000011111110000100111100011111110001111000111111111100011
111111111111111111111111111111111111111111111111111111111111111

That took more work than it was worth
Title: The Bumpy Thread
Post by: Venera on November 14, 2011, 08:17:58 PM
bump
Title: The Bumpy Thread
Post by: plymoth45 on November 14, 2011, 09:27:53 PM
Quote
Code: [Select]
111111111111111111111111111111111111111111111111111111111111111
110000000111111000111000111100000111000001111000000011111100011
110000000001111000111000111100000111000001111000000000111100011
110001110001111000111000111100000010000001111000111000111100011
110001110001111000111000111100000000000001111000111000111100011
110000000111111000111000111100010000010001111000000011111100011
110000000111111000111000111100010000010001111000000111111100011
110001110001111000111000111100011000110001111000111111111100011
110001110001111000010000111100011101110001111000111111111111111
110000000001111100000000111100011111110001111000111111111100011
110000000011111110000100111100011111110001111000111111111100011
111111111111111111111111111111111111111111111111111111111111111

That took more work than it was worth
How dare you bump in Binary! :P
Title: The Bumpy Thread
Post by: Hooman on November 15, 2011, 01:14:05 AM
You could have written code to draw that bump for you.
 
Title: The Bumpy Thread
Post by: CK9 on November 15, 2011, 01:22:15 AM
Code: [Select]
ACGACGCAGCGCGAGCGCCCAGCGACGCGGCAAAACGCGCGCGACCAGCCGGAAGCGAGCGA
ACTTTTTTTCCGAAGTTTAGCTTTAAGCTTTTTAGGTTTTTAGGTTTTTTTAGGACCTTTGC
CGTTTTTTTTTAGGATTTCCATTTCCACTTTTTGAATTTTTGAGTTTTTTTTTAAAGTTTCA
CGTTTAAATTTCCCATTTGGATTTCCAGTTTTTTGTTTTTTGGCTTTAGGTTTCCACTTTCC
GATTTGCATTTGGACTTTGGCTTTGGAGTTTTTTCTTTTTTAGGTTTACCTTTCAAGTTTAC
GCTTTTTTTAAAAAATTTCGATTTGGGGTTTCTTTTTGTTTAAATTTTTTTAGGCAATTTGG
AATTTTTTTCCGACCTTTGACTTTCCCCTTTCTTTTTATTTGGGTTTTTTAACCCAGTTTAG
CCTTTGGCTTTCCGATTTCAGTTTAACGTTTCCTTTCATTTCCCTTTGGACCACCACTTTAG
GGTTTCACTTTGGACTTTTATTTTGGAGTTTGGGTAGGTTTCCATTTACCAGACGAAACCAG
GATTTTTTTTTCGGGATTTTTTTTGGAGTTTAAGACGATTTACCTTTCAACGGAGCATTTAC
GCTTTTTTTAAGCCGACTTTTCTTCCCGTTTCCAGCCCTTTGACTTTCGACAGGACATTTGA
CCAGGGCACGGGACGGCGGAGCGCGCGAGCAGCGCAGACGAGCCCGAGCGAGGCAGCAGGCG

Bumping is in your DNA!
Title: The Bumpy Thread
Post by: Venera on November 15, 2011, 05:23:43 AM
should i be worried?

bump
Title: The Bumpy Thread
Post by: CK9 on November 15, 2011, 11:29:36 AM
bump?
Title: The Bumpy Thread
Post by: plymoth45 on November 15, 2011, 01:33:27 PM
Gotta say, that bump doesn't stand out as well as the 10001110 bump :P
Title: The Bumpy Thread
Post by: Venera on November 15, 2011, 01:42:05 PM
I bumpin' agree.
Title: The Bumpy Thread
Post by: plymoth45 on November 15, 2011, 01:49:26 PM
Still a creative bump...
Title: The Bumpy Thread
Post by: Venera on November 15, 2011, 01:59:01 PM
yeah.

bump
Title: The Bumpy Thread
Post by: plymoth45 on November 15, 2011, 02:18:44 PM
More creative bumps ck!
Title: The Bumpy Thread
Post by: Savant_Ace on November 15, 2011, 03:00:05 PM
Totobump.
Title: The Bumpy Thread
Post by: CK9 on November 15, 2011, 03:25:07 PM
I'd bump in hex, but I think it would stand out even worse than the DNA one, lol
Title: The Bumpy Thread
Post by: Venera on November 15, 2011, 03:43:16 PM
BUMPP
Title: The Bumpy Thread
Post by: plymoth45 on November 15, 2011, 04:31:19 PM
Mmmm hex... I used to be able to convert hex from binary by hand... But I can't remember how! Bump it!
Title: The Bumpy Thread
Post by: Spikerocks101 on November 15, 2011, 07:11:06 PM
1% of the bumps own 90% of the wealth. I'm the 99%.
Title: The Bumpy Thread
Post by: Venera on November 15, 2011, 07:17:58 PM
that's is bumping confusing to me.
Title: The Bumpy Thread
Post by: plymoth45 on November 15, 2011, 07:21:09 PM
Yeah I'm bumped on that one lol
Title: The Bumpy Thread
Post by: Venera on November 15, 2011, 08:29:33 PM
Bumpyscript.
Title: The Bumpy Thread
Post by: plymoth45 on November 15, 2011, 08:33:15 PM
plain bump
Title: The Bumpy Thread
Post by: Hooman on November 15, 2011, 10:37:11 PM
You double bumped!

For shame!
 
Title: The Bumpy Thread
Post by: CK9 on November 15, 2011, 10:59:16 PM
bump

binary: 0 1 10 11 ...
hex: 0 1 2 3 4 5 6 7 8 9 A B C D E F

You can still do it if you try :P
Title: The Bumpy Thread
Post by: plymoth45 on November 16, 2011, 05:31:58 AM
O.o how did that double bump happen? I only pressed the button once... Least I can still delete my own bumps :P
Title: The Bumpy Thread
Post by: CK9 on November 16, 2011, 12:09:17 PM
and then there was bump
Title: The Bumpy Thread
Post by: Venera on November 16, 2011, 03:18:05 PM
bump+bump=bump
Title: The Bumpy Thread
Post by: Hidiot on November 16, 2011, 05:37:38 PM
So, you mean to say that "bump" is the neutral element of the set of English words with regard to addition?
Title: The Bumpy Thread
Post by: Venera on November 16, 2011, 06:58:25 PM
Yep.  Bump is equal to 0.  However Bumpy is equal to 1.  So Bumpy\Bump=Lumpy.
Title: The Bumpy Thread
Post by: Hooman on November 16, 2011, 10:32:27 PM
Quote
O.o how did that double bump happen? I only pressed the button once... Least I can still delete my own bumps 

Well, I suppose it doesn't really matter since the bump operator is idempotent in regards to thread ordering. (Bumping the thread twice doesn't move it any higher up on the list the second time).
 
Title: The Bumpy Thread
Post by: Venera on November 17, 2011, 05:21:27 AM
bump
Title: The Bumpy Thread
Post by: plymoth45 on November 17, 2011, 06:12:04 AM
bump is just a figment of our imaginations :P
Title: The Bumpy Thread
Post by: Venera on November 17, 2011, 01:53:26 PM
imagination is a figment of itself when it sees the word bump
Title: The Bumpy Thread
Post by: CK9 on November 17, 2011, 07:15:29 PM
we need to go bumpier...
Title: The Bumpy Thread
Post by: Venera on November 17, 2011, 07:19:33 PM
yes we do. this thread has become to lumpy.

bump
Title: The Bumpy Thread
Post by: CK9 on November 17, 2011, 09:14:39 PM
b is for the way you are to be
u is for the uranium stockpiles
m is merry merry, topiary
p is ...ummm...p...
Title: The Bumpy Thread
Post by: Venera on November 17, 2011, 09:33:37 PM
meteor shower tonight.  hopefully it won't destroy my residence, my tubes, and the evac transport.

bump
Title: The Bumpy Thread
Post by: plymoth45 on November 18, 2011, 08:42:08 AM
Your Evac transport just got bumped...
Title: The Bumpy Thread
Post by: Hooman on November 19, 2011, 04:10:10 AM
Oh ouch.

If my evac transport got bumped by a meteor, well..., I'd be crushed!  :(
 
Title: The Bumpy Thread
Post by: Venera on November 19, 2011, 05:52:26 AM
Yay the stuff didn't bumped by a meteor.  Apparently on earth the meteors disappear most of the time unlike New Terra. >_>
Title: The Bumpy Thread
Post by: plymoth45 on November 19, 2011, 06:23:20 AM
I wouldn't be crushed :P cause I wouldn't be in the bumped evac lol
Title: The Bumpy Thread
Post by: Venera on November 19, 2011, 06:28:40 AM
I probably wouldn't either.  I'd run into the advanced residence or whatever the reinforced residence is.

bump
Title: The Bumpy Thread
Post by: Spikerocks101 on November 19, 2011, 07:44:06 AM
Bumpy rock in the house tonight, every budy just...
STOP PLAYING THAT BUMPING MUSIC!
Title: The Bumpy Thread
Post by: Venera on November 19, 2011, 09:31:23 AM
bump+blimp=blump.
Title: The Bumpy Thread
Post by: plymoth45 on November 20, 2011, 06:54:56 PM
Quote
Bumpy rock in the house tonight, every budy just...
STOP PLAYING THAT BUMPING MUSIC!
I like this bump :P
Title: The Bumpy Thread
Post by: Venera on November 20, 2011, 08:13:39 PM
bump
Title: The Bumpy Thread
Post by: plymoth45 on November 21, 2011, 01:05:06 PM
bump
Title: The Bumpy Thread
Post by: Venera on November 21, 2011, 04:27:28 PM
bump
Title: The Bumpy Thread
Post by: Spikerocks101 on November 21, 2011, 08:36:15 PM
dwnq
Title: The Bumpy Thread
Post by: Venera on November 22, 2011, 05:17:05 AM
bump
Title: The Bumpy Thread
Post by: Savant_Ace on November 22, 2011, 10:27:15 AM
Your BuMp is weak!
Title: The Bumpy Thread
Post by: plymoth45 on November 22, 2011, 01:00:21 PM
Well so is your bump!
Title: The Bumpy Thread
Post by: CK9 on November 22, 2011, 01:43:20 PM
I hate bumping holidays, I get stuck cleaning all day when maybe 1% of the mess is from me and the person who 80% of the mess is from pretends to clean and isn't ever called out on it (any time I do, I'm forced to drop it "to keep the peace" -.-)
Title: The Bumpy Thread
Post by: plymoth45 on November 22, 2011, 05:03:08 PM
Sounds like a horrible bumping place..
Title: The Bumpy Thread
Post by: Savant_Ace on November 22, 2011, 09:54:04 PM
At least my BuMp has the power to Rock! What does your bump do? Demasculate others with a barrage of constant nagging?
Title: The Bumpy Thread
Post by: Hooman on November 23, 2011, 01:18:52 AM
Hmm..., I wonder what would happen if I setup the word filter on the forum to replace "bump" with a horrible swear word? People use it in the same context and verb-ify it and everything. It'd fit right in. ;)

...probably a really bumping bad idea though.



...or maybe just a little unnecessary censorship. Star it out to make it look really bad. ;)


Nah, probably a bumping bad idea.  :unsure:
 
Title: The Bumpy Thread
Post by: plymoth45 on November 23, 2011, 10:38:41 AM
Yeah, if you bumped up like that, I'de have to start sayin |3|_|/\/\|>
Title: The Bumpy Thread
Post by: Spikerocks101 on November 23, 2011, 11:13:03 AM
or replace bump with a completely unfitting word like "cat", and make a mess of everything.
Title: The Bumpy Thread
Post by: CK9 on November 23, 2011, 12:24:28 PM
there once was a farmer who lived on a rock...

if you know that bumpy song, than you know a funny song
Title: The Bumpy Thread
Post by: Venera on November 23, 2011, 01:04:36 PM
The bumption song.
Title: The Bumpy Thread
Post by: plymoth45 on November 23, 2011, 03:18:35 PM
bump?
Title: The Bumpy Thread
Post by: CK9 on November 23, 2011, 04:50:32 PM
bump!
Title: The Bumpy Thread
Post by: Hooman on November 23, 2011, 10:54:31 PM
He sat in the meadow just shaking his fist...

Or was he bumping his fist?
 
Title: The Bumpy Thread
Post by: Venera on November 24, 2011, 07:54:03 AM
bump
Title: The Bumpy Thread
Post by: Savant_Ace on November 24, 2011, 08:17:41 AM
Talking about farmers bumping fists.... This bumping thread became pretty erotic all of a sudden....
Title: The Bumpy Thread
Post by: Hooman on November 24, 2011, 08:51:14 PM
I blame CK9 for bringing up that bumping song.

You can YouTube it if you want.


... and it was actually pretty funny.  :lol:
 
Title: The Bumpy Thread
Post by: CK9 on November 24, 2011, 09:24:53 PM
it's bumping hilarious!
Title: The Bumpy Thread
Post by: Venera on November 24, 2011, 09:51:23 PM
marching bump
Title: The Bumpy Thread
Post by: Spikerocks101 on November 24, 2011, 10:22:51 PM
I'm telling you. She was just sitting in the bar all alone. She was hot. She must have had the largest bumps I've ever seen. Man, I wish I posted on her threads. We would have IRCed at first, but going back to her place, we'd be up all night Outpost 2ing each other.
Title: The Bumpy Thread
Post by: CK9 on November 26, 2011, 04:52:00 PM
what the bump!
Title: The Bumpy Thread
Post by: Venera on November 26, 2011, 10:02:21 PM
lol
 bump
Title: The Bumpy Thread
Post by: CK9 on November 28, 2011, 08:26:25 PM
overly tired bump
Title: The Bumpy Thread
Post by: Venera on November 28, 2011, 08:42:01 PM
thisisaquotablebump
Title: The Bumpy Thread
Post by: Spikerocks101 on November 28, 2011, 08:56:04 PM
.com? (http://bump)
Title: The Bumpy Thread
Post by: Venera on November 29, 2011, 05:20:45 AM
Quote
thisisaquotablebump
iknewit
Title: The Bumpy Thread
Post by: CK9 on November 29, 2011, 10:06:16 PM
y u no bump spaces?
Title: The Bumpy Thread
Post by: Hooman on November 29, 2011, 10:52:06 PM
WhatbumpAbumpSillybumpIdea.
 
Title: The Bumpy Thread
Post by: Spikerocks101 on November 30, 2011, 07:00:49 AM
Bailout bump
Title: The Bumpy Thread
Post by: CK9 on November 30, 2011, 11:42:00 AM
bippity boppity bump
Title: The Bumpy Thread
Post by: Venera on November 30, 2011, 07:07:58 PM
becausethisbumpispostedpublicly
Title: The Bumpy Thread
Post by: CK9 on December 02, 2011, 07:30:59 PM
bump
Title: The Bumpy Thread
Post by: Venera on December 03, 2011, 05:31:12 AM
Quote
becausethisbumpispostedpublicly
and this one is quoted publicly
Title: The Bumpy Thread
Post by: CK9 on December 03, 2011, 07:53:21 PM
bumping vicariously?
Title: The Bumpy Thread
Post by: Spikerocks101 on December 03, 2011, 09:09:44 PM
To B, or not to B, that is the umption.
Title: The Bumpy Thread
Post by: Venera on December 04, 2011, 06:54:58 AM
bump
Title: The Bumpy Thread
Post by: CK9 on December 04, 2011, 09:39:15 PM
bump
Title: The Bumpy Thread
Post by: Spikerocks101 on December 04, 2011, 10:33:50 PM
bump
Title: The Bumpy Thread
Post by: CK9 on December 05, 2011, 12:12:30 PM
bumpa cola: 10 times the caffine of an expresso!
Title: The Bumpy Thread
Post by: Spikerocks101 on December 05, 2011, 02:27:40 PM
Bump

Also, ever notice that 10% of all posts on this forum are from CK9?
Title: The Bumpy Thread
Post by: CK9 on December 06, 2011, 11:01:25 PM
what are you trying to bump? :P
Title: The Bumpy Thread
Post by: Venera on December 07, 2011, 02:12:10 PM
Is that good, terrible, bad, or just plain bumpy?
Title: The Bumpy Thread
Post by: CK9 on December 08, 2011, 10:54:19 AM
isn't that in the eye of the bumpholder?
Title: The Bumpy Thread
Post by: Spikerocks101 on December 08, 2011, 12:01:26 PM
My +2 bumpsword damages u for 3 points
Title: The Bumpy Thread
Post by: CK9 on December 09, 2011, 12:05:55 PM
*bumps you with atomicbump*
Title: The Bumpy Thread
Post by: Venera on December 10, 2011, 06:50:17 AM
bumpy hydrogen bomb?
Title: The Bumpy Thread
Post by: CK9 on December 10, 2011, 10:36:06 AM
that's more than just a bump in the night
Title: The Bumpy Thread
Post by: plymoth45 on December 11, 2011, 07:55:35 PM
Quote
.com? (http://bump)
What a hidden bump...
Title: The Bumpy Thread
Post by: CK9 on December 12, 2011, 01:46:32 AM
can you see the ninja in this post?  That's because he's bumpy
Title: The Bumpy Thread
Post by: Flashy on December 13, 2011, 06:26:55 AM
plain old bump
Title: The Bumpy Thread
Post by: CK9 on December 13, 2011, 10:02:19 AM
we're only at 69 bumpy pages
Title: The Bumpy Thread
Post by: plymoth45 on December 13, 2011, 08:49:37 PM
We will continue to bump until we can bump no longer
Title: The Bumpy Thread
Post by: CK9 on December 13, 2011, 09:27:20 PM
bump
Title: The Bumpy Thread
Post by: Spikerocks101 on December 14, 2011, 09:35:38 PM
bump
Title: The Bumpy Thread
Post by: CK9 on December 15, 2011, 12:03:03 PM
bump
Title: The Bumpy Thread
Post by: Flashy on December 15, 2011, 12:51:11 PM
With every bump YOU can contribute to reach 100 pages of bumps. Yes, YOU!
Title: The Bumpy Thread
Post by: CK9 on December 15, 2011, 08:46:23 PM
bump?
Title: The Bumpy Thread
Post by: plymoth45 on December 16, 2011, 03:49:31 PM
bump ck! bump!
Title: The Bumpy Thread
Post by: CK9 on December 18, 2011, 12:49:08 PM
BUMP!
Title: The Bumpy Thread
Post by: Spikerocks101 on December 19, 2011, 07:09:35 PM
Anti-Bumb.
Title: The Bumpy Thread
Post by: CK9 on December 19, 2011, 08:09:07 PM
ooo I'm sorry, Bumb is not the same as bump and therefore we must disqualify you from this competition.  Plym, tell him what prizes he could have won!
Title: The Bumpy Thread
Post by: Spikerocks101 on December 29, 2011, 10:42:17 AM
CK9, your bump was so awkward, no one responded till now. LOLOLOLOLOLOLOL >_>
Title: The Bumpy Thread
Post by: CK9 on January 01, 2012, 05:11:09 AM
I was really bumping hopeful plym would check the forum and play along =/
Title: The Bumpy Thread
Post by: Spikerocks101 on January 01, 2012, 10:25:37 AM
Second bump of 2012
Title: The Bumpy Thread
Post by: CK9 on January 01, 2012, 03:40:08 PM
I hope we reach 100 pages of bump before 2013...
Title: The Bumpy Thread
Post by: plymoth45 on January 03, 2012, 06:49:41 AM
Yeah I bumped off momentarily. My bad.
Title: The Bumpy Thread
Post by: CK9 on January 03, 2012, 11:32:51 AM
Well, any bumping idea what you would have said if you hadn't been drifting off?
Title: The Bumpy Thread
Post by: plymoth45 on January 04, 2012, 01:22:06 PM
Behind door #1 we had: A lump of Bump
Behind door #2: A new bumpicle!
And last, but certain not least, behind door number 3: A Bump center!
Title: The Bumpy Thread
Post by: Venera on January 04, 2012, 06:31:00 PM
bump
Title: The Bumpy Thread
Post by: CK9 on January 05, 2012, 02:43:44 AM
three bumpy choices and 30 pages to go
Title: The Bumpy Thread
Post by: angellus on January 06, 2012, 12:13:31 AM
Bump?
Title: The Bumpy Thread
Post by: Spikerocks101 on January 06, 2012, 10:07:48 AM
Bonald Trump
Title: The Bumpy Thread
Post by: Flashy on January 06, 2012, 02:07:43 PM
bump
Title: The Bumpy Thread
Post by: CK9 on January 07, 2012, 10:48:10 PM
bump
Title: The Bumpy Thread
Post by: jcj94 on January 09, 2012, 07:19:48 AM
A WILD BUMP APPEARS.

IT USES OUTPOST 2.

ITS SUPER EFFECTIVE.
Title: The Bumpy Thread
Post by: Flashy on January 09, 2012, 03:18:45 PM
bump

Whats with all these memes recently
Title: The Bumpy Thread
Post by: plymoth45 on January 09, 2012, 05:26:43 PM
all your bump are belong to bump
Title: The Bumpy Thread
Post by: CK9 on January 09, 2012, 10:10:58 PM
Do you ever wonder if the bumpy thread is a major part of what's keeping this forum alive?
Title: The Bumpy Thread
Post by: plymoth45 on January 10, 2012, 05:53:35 AM
Actually it wouldn't surprise me. Bump!
Title: The Bumpy Thread
Post by: jcj94 on January 10, 2012, 06:26:08 AM
This bumpy thread keeps bumping alone. Whatyah say if we try for 200 pages of bumps after we hit our 100? :D
Title: The Bumpy Thread
Post by: Flashy on January 10, 2012, 11:08:01 AM
The thread isn't always bumping, but when it does, it progresses fairly well.
Title: The Bumpy Thread
Post by: CK9 on January 10, 2012, 11:13:33 AM
big wheel keeps on bumping...
Title: The Bumpy Thread
Post by: plymoth45 on January 11, 2012, 05:06:09 PM
Or the bump keeps on turning...
Title: The Bumpy Thread
Post by: CK9 on January 11, 2012, 05:36:25 PM
Rolling on a bump
Title: The Bumpy Thread
Post by: Spikerocks101 on January 11, 2012, 10:05:18 PM
dumq
Title: The Bumpy Thread
Post by: plymoth45 on January 12, 2012, 05:46:57 AM
bump wars!
Title: The Bumpy Thread
Post by: CK9 on January 12, 2012, 10:02:35 AM
leaving a bump in the road
Title: The Bumpy Thread
Post by: plymoth45 on January 12, 2012, 11:29:49 AM
just have to trek over that bump :P
Title: The Bumpy Thread
Post by: CK9 on January 12, 2012, 08:06:12 PM
you got bumps in your bump?
Title: The Bumpy Thread
Post by: Spikerocks101 on January 13, 2012, 09:12:57 AM
El bumbio
Title: The Bumpy Thread
Post by: CK9 on January 13, 2012, 11:21:47 AM
bump
Title: The Bumpy Thread
Post by: plymoth45 on January 14, 2012, 08:54:19 AM
Ssssssssss bump
Title: The Bumpy Thread
Post by: Flashy on January 14, 2012, 09:11:47 AM
Sbump? Spumb?
Title: The Bumpy Thread
Post by: CK9 on January 14, 2012, 10:46:29 AM
a bumper?
Title: The Bumpy Thread
Post by: plymoth45 on January 14, 2012, 05:18:50 PM
no, a bumpit
Title: The Bumpy Thread
Post by: Flashy on January 14, 2012, 05:25:02 PM
Now you have a new bump of yourself in the shout box
Title: The Bumpy Thread
Post by: CK9 on January 15, 2012, 12:08:54 AM
lobump
Title: The Bumpy Thread
Post by: plymoth45 on January 15, 2012, 06:11:32 AM
threaded bump
Title: The Bumpy Thread
Post by: Flashy on January 15, 2012, 08:52:04 AM
I wonder who will bump the 100th page... And what the price will be
Title: The Bumpy Thread
Post by: CK9 on January 15, 2012, 01:57:25 PM
if the pace slows down too much one person might spam bump to get it there...and the price will be a temp ban, lol
Title: The Bumpy Thread
Post by: plymoth45 on January 15, 2012, 04:53:25 PM
Would that person have bumped above?
Title: The Bumpy Thread
Post by: CK9 on January 15, 2012, 08:12:02 PM
abump where?
 
Title: The Bumpy Thread
Post by: plymoth45 on January 15, 2012, 08:50:56 PM
look at the next bump! It will contain the key!
Title: The Bumpy Thread
Post by: Spikerocks101 on January 15, 2012, 10:39:58 PM
No bump today, my love has gone away. The company was gay, we'd turned night into day.
Title: The Bumpy Thread
Post by: CK9 on January 16, 2012, 11:44:23 AM
bump bump BUUUUUUUUUUUUUUUUUUUUUUUUMMMMMMMMMMMP!

that's supposed to be the one tune that is used when there is a horrible reveal

 
Title: The Bumpy Thread
Post by: plymoth45 on January 16, 2012, 05:49:58 PM
bump
Title: The Bumpy Thread
Post by: jcj94 on January 17, 2012, 08:08:08 AM
Quote
bump bump BUUUUUUUUUUUUUUUUUUUUUUUUMMMMMMMMMMMP!

that's supposed to be the one tune that is used when there is a horrible reveal
DRAMATIC BUMP IS DRAMATIC!
Title: The Bumpy Thread
Post by: CK9 on January 17, 2012, 10:29:36 AM
bumpfully delicious!
Title: The Bumpy Thread
Post by: Spikerocks101 on January 17, 2012, 04:54:03 PM
Ump. What is Ump? Can Ump fly? Can Ump run? All we know is, it can Bump, it is owned by Donald Trump, sometimes Thumps, has no Lump, and rhymes with Octopus.
Title: The Bumpy Thread
Post by: CK9 on January 17, 2012, 11:16:03 PM
bump bump
Title: The Bumpy Thread
Post by: plymoth45 on January 18, 2012, 06:07:26 AM
holy bump spike, far too many umps in that bump :P
Title: The Bumpy Thread
Post by: Spikerocks101 on January 18, 2012, 09:40:28 AM
CVNQ
Title: The Bumpy Thread
Post by: CK9 on January 18, 2012, 10:13:07 AM
NO BUMP!  RAGE MOB!
Title: The Bumpy Thread
Post by: plymoth45 on January 21, 2012, 11:29:43 AM
GET IM BOYS! HE DIDN"T BUMP! BUMP HIM TO DEATH! I CALL ON THE ARMY OF BUMPS!!

BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP! BUMP!  
Title: The Bumpy Thread
Post by: CK9 on January 21, 2012, 12:08:04 PM
bumps from around the world:
Thai: ลูกโป่ง (Lūkpòng)
Afrokaans: stamp
Albanian: përplasem
Arabic: نتوء
Armenian: զարկվել (zarkvel)
Azerbaijani: tuluq
Basque: erliebe
Belarusian: ўдар (ŭdar)
Bengali: আচমকা (Ācamakā)
Bulgarian: неравност (neravnost)
Catalan: sot

and that's as far as I'm going in this post :P
Title: The Bumpy Thread
Post by: plymoth45 on January 22, 2012, 09:39:42 PM
Pissed off and slightly hurt bump. >.< Women piss me off
Title: The Bumpy Thread
Post by: CK9 on January 23, 2012, 12:56:48 PM
you got a bad case of the bumps there plym?
Title: The Bumpy Thread
Post by: plymoth45 on January 23, 2012, 01:03:58 PM
You could bump that.
Title: The Bumpy Thread
Post by: CK9 on January 23, 2012, 05:40:03 PM
*bumps on a harmonica*
Title: The Bumpy Thread
Post by: plymoth45 on January 24, 2012, 05:49:42 AM
the blues bump?
Title: The Bumpy Thread
Post by: CK9 on January 24, 2012, 10:21:01 AM
you bumped it right :)
Title: The Bumpy Thread
Post by: plymoth45 on January 25, 2012, 05:46:20 AM
DO I get a bumpin cigar or what? lol :P
Title: The Bumpy Thread
Post by: CK9 on January 25, 2012, 10:26:56 PM
bump it
Title: The Bumpy Thread
Post by: plymoth45 on January 26, 2012, 08:48:43 AM
bop it bump
Title: The Bumpy Thread
Post by: CK9 on January 26, 2012, 11:04:17 PM
bumping up a ladder  
Title: The Bumpy Thread
Post by: Venera on January 27, 2012, 11:44:35 PM
bump
Title: The Bumpy Thread
Post by: Hooman on January 28, 2012, 01:17:49 AM
Bumping down a snake.
 
Title: The Bumpy Thread
Post by: plymoth45 on January 28, 2012, 05:53:22 AM
bumping up that hill
Title: The Bumpy Thread
Post by: CK9 on January 28, 2012, 10:04:53 AM
and when you bump you bump, and when you pmub you pmub, and when you're only halfway bump, you're neither bump nor pmub
Title: The Bumpy Thread
Post by: plymoth45 on January 29, 2012, 04:03:57 PM
Hall of bumps?
Title: The Bumpy Thread
Post by: CK9 on January 29, 2012, 06:10:37 PM
bump the bumping bumper...
Title: The Bumpy Thread
Post by: plymoth45 on January 29, 2012, 06:44:46 PM
I don't want to bump the bumping bumper! The bumper bumped me!
Title: The Bumpy Thread
Post by: CK9 on January 29, 2012, 11:25:49 PM
the bump is on my bump!
Title: The Bumpy Thread
Post by: plymoth45 on January 30, 2012, 01:40:35 PM
bump bump bump bump bump. Bump.
Title: The Bumpy Thread
Post by: CK9 on January 30, 2012, 02:51:30 PM
mbpu

inside out bump :P
Title: The Bumpy Thread
Post by: plymoth45 on January 30, 2012, 07:00:13 PM
I will have the last bump!
Title: The Bumpy Thread
Post by: Spikerocks101 on January 30, 2012, 07:21:30 PM
Walmart Bunp. Made in China, so it isn't quite the same as the other bumps :/
Title: The Bumpy Thread
Post by: plymoth45 on January 30, 2012, 08:06:34 PM
bump-i-lally bump-i-lally bumpy what a day
Title: The Bumpy Thread
Post by: CK9 on January 30, 2012, 09:15:47 PM
Bumpin Hood?
Title: The Bumpy Thread
Post by: Spikerocks101 on January 30, 2012, 10:12:02 PM
What is the airspeed velocity of a maiden bumped?
Title: The Bumpy Thread
Post by: CK9 on January 30, 2012, 10:13:40 PM
Why are you bumping maidens in that manner?
Title: The Bumpy Thread
Post by: plymoth45 on January 31, 2012, 07:38:25 AM
"What... is your bump!?" "My bump is bump!"
Title: The Bumpy Thread
Post by: CK9 on January 31, 2012, 10:09:55 AM
bummp
Title: The Bumpy Thread
Post by: plymoth45 on February 01, 2012, 03:32:14 PM
kannst ich bump?
Title: The Bumpy Thread
Post by: CK9 on February 01, 2012, 04:18:16 PM
NEIN!  NEIN bump fur dich!
Title: The Bumpy Thread
Post by: Hidiot on February 01, 2012, 09:40:42 PM
You mean "kein" bump fur dich... or keine, depending on what gender bump is.
Title: The Bumpy Thread
Post by: CK9 on February 01, 2012, 10:31:11 PM
Kein is no?  Well bump me...
Title: The Bumpy Thread
Post by: Hidiot on February 01, 2012, 11:14:59 PM
Nein and kein are both "no", except kein is used instead of nein when referring to objects.

And I assume a bump is an object.
Title: The Bumpy Thread
Post by: plymoth45 on February 02, 2012, 06:14:08 AM
Bump me as well...
Title: The Bumpy Thread
Post by: Spikerocks101 on February 02, 2012, 09:32:11 AM
I think Human to Well surgery is not that easy. Guess your bumped.
Title: The Bumpy Thread
Post by: CK9 on February 02, 2012, 10:22:33 AM
Seeing as I learned everything I know about german from listening to Rammstein, I think I bumping did okay, lol
Title: The Bumpy Thread
Post by: plymoth45 on February 03, 2012, 06:39:18 AM
ok, breaking the foreign language debate bumps: Bump commander
Title: The Bumpy Thread
Post by: Spikerocks101 on February 03, 2012, 11:00:27 AM
Bump Comrade
Title: The Bumpy Thread
Post by: CK9 on February 03, 2012, 11:22:44 AM
bump?
Title: The Bumpy Thread
Post by: plymoth45 on February 04, 2012, 06:04:47 AM
Bump commandant
Title: The Bumpy Thread
Post by: CK9 on February 04, 2012, 09:06:08 AM
beaker bump
Title: The Bumpy Thread
Post by: jcj94 on February 06, 2012, 03:03:36 PM
Borken bump...

It bumped so hard it borked the work.
Title: The Bumpy Thread
Post by: CK9 on February 07, 2012, 03:06:04 AM
Can you see a bump that has gone AWOL?
Title: The Bumpy Thread
Post by: Freeza-CII on February 07, 2012, 09:08:10 AM
if a bump happens with no one around does it still happen
Title: The Bumpy Thread
Post by: CK9 on February 07, 2012, 03:12:01 PM
It does if it's bumping fantastic!
Title: The Bumpy Thread
Post by: Spikerocks101 on February 07, 2012, 06:40:03 PM
Bump me. Bump you. Oh yeah? Says who?
Title: The Bumpy Thread
Post by: Venera on February 07, 2012, 09:05:27 PM
Me says bump.
Title: The Bumpy Thread
Post by: CK9 on February 07, 2012, 10:06:36 PM
The good, the bad, and the bumpy...


did I use that one already?
Title: The Bumpy Thread
Post by: plymoth45 on February 08, 2012, 06:12:27 AM
fast and furious hit a bump
Title: The Bumpy Thread
Post by: CK9 on February 08, 2012, 03:21:35 PM
74 pages of bump on the wall, 74 pages of bump...
Title: The Bumpy Thread
Post by: Venera on February 09, 2012, 03:19:41 PM
take one down pass it around 74 pages of bump on the wall.
Title: The Bumpy Thread
Post by: Spikerocks101 on February 09, 2012, 03:43:54 PM
Divide it by 6, just for the kicks, 12.33 pages of bump on the wall
Title: The Bumpy Thread
Post by: Venera on February 09, 2012, 06:55:30 PM
12.33 pages of bump on the wall, 12.33 pages of bump....
Title: The Bumpy Thread
Post by: CK9 on February 09, 2012, 10:51:05 PM
Gntlemen, we have bump
Title: The Bumpy Thread
Post by: plymoth45 on February 10, 2012, 03:08:25 PM
bump bomb!
Title: The Bumpy Thread
Post by: CK9 on February 10, 2012, 06:50:02 PM
badsgargareafuafafaegaegagamafagagaererap

yup...
Title: The Bumpy Thread
Post by: Venera on February 10, 2012, 11:16:42 PM
Houston, we have a bump.
Title: The Bumpy Thread
Post by: plymoth45 on February 11, 2012, 09:46:53 AM
almost didn't see your bump in there lol
Title: The Bumpy Thread
Post by: CK9 on February 11, 2012, 11:47:50 AM
and that encoded bump was the last of page 74!  We are 3/4 of the way to 100!
Title: The Bumpy Thread
Post by: Spikerocks101 on February 11, 2012, 12:36:03 PM
I know not what weapons world war 3 will be fought with, but world war 4 will be fought with BUMPS.
Title: The Bumpy Thread
Post by: CK9 on February 12, 2012, 12:13:58 AM
does that mean...oh bump!
Title: The Bumpy Thread
Post by: Lord Of Pain on February 21, 2012, 11:33:07 AM
MOTHERBUMPING BUMPTARD! i'll see you down in bumpville...... BUMP YOU!!!!!!!!!!!!!
Title: The Bumpy Thread
Post by: CK9 on February 21, 2012, 11:49:22 AM
bump off
Title: The Bumpy Thread
Post by: Spikerocks101 on February 27, 2012, 02:26:44 PM
bump
Title: The Bumpy Thread
Post by: CK9 on February 27, 2012, 11:06:20 PM
slloooooooooooowwwwwwww bump
Title: The Bumpy Thread
Post by: Venera on March 09, 2012, 01:17:48 PM
fast bump
Title: The Bumpy Thread
Post by: CK9 on March 09, 2012, 03:18:14 PM
just your average bump
Title: The Bumpy Thread
Post by: Lugia3 on March 09, 2012, 04:52:56 PM
Affirmative. Bump thread with 25 kiloton NUKLEARES WAFFENARSENAL.
Title: The Bumpy Thread
Post by: CK9 on March 09, 2012, 05:49:18 PM
General Bumpington!
Title: The Bumpy Thread
Post by: Venera on March 11, 2012, 11:58:47 AM
Bump
bUmp
buMp
bumP
Title: The Bumpy Thread
Post by: CK9 on March 11, 2012, 06:09:59 PM
bump
Title: The Bumpy Thread
Post by: Venera on March 18, 2012, 09:24:10 PM
Made bumping excellent at my orchestra competition.  YAY!!!!
Title: The Bumpy Thread
Post by: CK9 on March 18, 2012, 10:33:38 PM
bumping 'gratz
Title: The Bumpy Thread
Post by: Spikerocks101 on March 19, 2012, 11:30:50 AM
Bump Springsteen
Title: The Bumpy Thread
Post by: CK9 on March 19, 2012, 12:28:35 PM
1 week spring break bump, lol
Title: The Bumpy Thread
Post by: Venera on March 19, 2012, 01:43:50 PM
bump
Title: The Bumpy Thread
Post by: CK9 on March 19, 2012, 07:11:49 PM
*poke*

err...I mean bump!
Title: The Bumpy Thread
Post by: jcj94 on March 20, 2012, 08:46:46 AM
Debumped from the bump of the abumpable unibump.
Title: The Bumpy Thread
Post by: CK9 on March 20, 2012, 04:36:04 PM
bump?
Title: The Bumpy Thread
Post by: Venera on March 21, 2012, 05:19:17 AM
bump
Title: The Bumpy Thread
Post by: CK9 on March 21, 2012, 09:55:49 AM
my bumping hand!
Title: The Bumpy Thread
Post by: Venera on March 21, 2012, 08:34:40 PM
I'm trying to bumping get back into OP2.
Title: The Bumpy Thread
Post by: CK9 on March 21, 2012, 09:21:44 PM
bump
Title: The Bumpy Thread
Post by: Venera on March 22, 2012, 05:21:51 AM
bump
Title: The Bumpy Thread
Post by: CK9 on March 22, 2012, 09:45:31 AM
only 24 pages of bump to go, lol
Title: The Bumpy Thread
Post by: Venera on March 22, 2012, 05:33:33 PM
shall we start again?  (EDIT:  By this I mean starting that pages of bump song again.)

76 pages of bump on the wall, 76 pages of bump, post some more, invite a few, 76.x pages of bump on the wall.
Title: The Bumpy Thread
Post by: CK9 on March 22, 2012, 07:12:10 PM
bump me
Title: The Bumpy Thread
Post by: Venera on March 23, 2012, 05:28:47 AM
bump
Title: The Bumpy Thread
Post by: Lord Of Pain on March 23, 2012, 07:15:07 AM
Luke, I Am you're BUMPER!

@jcj: why are you ignoring me so much? im sorry if i was acting wierd but hey you just gotta accept people for who they are besides being afriad of what you don't understand and shunning me for it won't help anything. please jcj lets play a game or somthing. Wanna play minecraft? i'll even play a game of op2 if you ask me.

@opu: blaryflaarge (YES IM STILL HERE :P)

@currentpostersinthread: come on i leave home for a few days and look what happens. :(

ok so i wanna see some unique bumps like good pictures like the ones i made last year. That be alsome though highly unlikely.... its one thing to have a quantity of bumps its different to have good quality of bumps.

i know it was originally suppost to be quantity but lets face it we need some sparkle otherwise we could basically just keep posting:

spike: bump
sirbomber: bump
jcj: bump
subbed: bump
spike: bump
arklon: bump
spike: bump
spike: bump
sirbomber: bump
jcj: bump
subbed: bump
spike: bump
arklon: bump
spike: bump


see how much of an eye sore that would be? now trust me its a bit exagerated.
pics would make this thread alsome just plane better.

if you dont want to thats fine too.  
Title: The Bumpy Thread
Post by: Venera on March 23, 2012, 08:38:29 PM
BUMP
Title: The Bumpy Thread
Post by: CK9 on March 23, 2012, 11:43:55 PM
pics would slow down the load time bump
Title: The Bumpy Thread
Post by: Venera on March 24, 2012, 05:45:16 AM
[size=8]bump[/size][/i][/b][/font]
Title: The Bumpy Thread
Post by: Flashy on March 24, 2012, 09:05:44 AM
bump
Title: The Bumpy Thread
Post by: CK9 on March 24, 2012, 10:50:48 AM
bump
Title: The Bumpy Thread
Post by: Venera on March 25, 2012, 01:22:54 PM
bump
Title: The Bumpy Thread
Post by: Lugia3 on March 31, 2012, 08:41:34 PM
. . . . . . . . . . . . . __bump__
. . . . . . . . . . . . ./ / / / / \ \ \ \
. . . . . . . . . . . . / / / / / | \ \ \ \
. . . . . . . . . . . ./ / / / / /|\ \ \ \ \
. . . . . . . . . . . / / / / / / | \ \ \ \ \
. . . . . . . . . . ./ / / / / / /|\ \ \ \ \ \
. . . . . . . . . . / / / / / / / | \ \ \ \ \ \
_________/ / / / / / / / \ \ \ \ \ \ \ \_____________
Title: The Bumpy Thread
Post by: Venera on March 31, 2012, 08:44:23 PM
bump
Title: The Bumpy Thread
Post by: CK9 on April 01, 2012, 11:00:30 PM
hangnail bump
Title: The Bumpy Thread
Post by: Venera on April 02, 2012, 07:08:53 PM
Bump Notice
Title: The Bumpy Thread
Post by: Freeza-CII on April 03, 2012, 04:30:58 AM
this is a 29 bit bump
Title: The Bumpy Thread
Post by: Lord Of Pain on April 09, 2012, 06:46:09 AM
gimmeh my bumping sushi back you Jump-wagon! :P
Title: The Bumpy Thread
Post by: CK9 on April 09, 2012, 10:54:13 AM
bumpity bumpity bump, the mouse ran up the bump
Title: The Bumpy Thread
Post by: Venera on April 09, 2012, 12:21:49 PM
Quote
this is a 29 bit bump
this is a 45 bit bump.
Title: The Bumpy Thread
Post by: Flashy on May 02, 2012, 02:59:36 PM
Darn i bumped too early
Title: The Bumpy Thread
Post by: Spikerocks101 on May 02, 2012, 04:09:31 PM
-_-

Now we need to wait another bumping month...
Title: The Bumpy Thread
Post by: Venera on May 02, 2012, 06:11:00 PM
no
bump
Title: The Bumpy Thread
Post by: CK9 on May 02, 2012, 07:53:47 PM
I don't bumping get it...
Title: The Bumpy Thread
Post by: Spikerocks101 on May 03, 2012, 10:55:55 AM
It was almost a month since the last time someone bumbed (only 7 days short).
Title: The Bumpy Thread
Post by: Venera on May 03, 2012, 05:10:14 PM
bump
Title: The Bumpy Thread
Post by: CK9 on May 03, 2012, 10:27:59 PM
well bump that!
Title: The Bumpy Thread
Post by: Spikerocks101 on May 04, 2012, 07:50:46 AM
Original Bump
Title: The Bumpy Thread
Post by: Flashy on May 04, 2012, 03:36:44 PM
Bump
Title: The Bumpy Thread
Post by: Venera on May 04, 2012, 05:17:27 PM
b
bu
bum
bump
bumpb
bumpbu
bumpbum
bumpbump
bumpbum
bumpbu
bumpb
bump
bum
bu
b
Title: The Bumpy Thread
Post by: CK9 on May 04, 2012, 07:15:56 PM
bump
Title: The Bumpy Thread
Post by: Venera on May 05, 2012, 04:16:37 AM
bump
Title: The Bumpy Thread
Post by: CK9 on May 05, 2012, 10:40:32 AM
bumbumbup
Title: The Bumpy Thread
Post by: Venera on May 05, 2012, 08:47:44 PM
bump
Title: The Bumpy Thread
Post by: CK9 on May 06, 2012, 02:36:31 PM
kitty cat bump
 
Title: The Bumpy Thread
Post by: Venera on May 06, 2012, 02:51:59 PM
speed bump
Title: The Bumpy Thread
Post by: Spikerocks101 on May 07, 2012, 08:24:59 PM
dump bump
Title: The Bumpy Thread
Post by: Venera on May 08, 2012, 04:19:47 AM
bump
Title: The Bumpy Thread
Post by: Spikerocks101 on May 08, 2012, 09:27:23 AM
Slow Bump
Title: The Bumpy Thread
Post by: Venera on May 08, 2012, 03:10:18 PM
Code: [Select]
PRINT "Bump"
SLEEP
Title: The Bumpy Thread
Post by: Flashy on May 14, 2012, 01:25:41 PM
another simple bump
Title: The Bumpy Thread
Post by: Spikerocks101 on May 14, 2012, 02:43:37 PM
aBcdefghijklMnoPqrstUvwxyz
Title: The Bumpy Thread
Post by: Venera on May 14, 2012, 03:42:31 PM
bump
Title: The Bumpy Thread
Post by: CK9 on May 14, 2012, 04:02:16 PM
I'd bump in hx, but that would require knowledge of the letter values...which I don't have
Title: The Bumpy Thread
Post by: Venera on May 14, 2012, 06:54:51 PM
Code: [Select]
<?php
die("BUMP!");
?>
Title: The Bumpy Thread
Post by: CK9 on May 14, 2012, 09:16:36 PM
Guess what I found?

62756d70

http://www.string-functions.com/string-hex.aspx (http://www.string-functions.com/string-hex.aspx)
Title: The Bumpy Thread
Post by: Spikerocks101 on May 15, 2012, 01:20:13 AM
3632373536643730
Title: The Bumpy Thread
Post by: CK9 on May 15, 2012, 09:04:29 AM
bumping fun tool
Title: The Bumpy Thread
Post by: Venera on May 15, 2012, 11:08:08 AM
Code: [Select]
<?php
echo "bump";
?>
Title: The Bumpy Thread
Post by: Spikerocks101 on May 15, 2012, 04:16:24 PM
B*MP
Title: The Bumpy Thread
Post by: CK9 on May 15, 2012, 04:42:26 PM
Code: [Select]
<?php
$bump = fopen('bump.txt', r);
$say = explode('\n', $bump);
echo $say;
?>
Title: The Bumpy Thread
Post by: Spikerocks101 on May 15, 2012, 06:27:49 PM
printf("BUMP");
Title: The Bumpy Thread
Post by: Venera on May 15, 2012, 07:38:42 PM
Code: [Select]
<?php
if (file_exists("bump.txt")) {
 $evilness = file_get_contents("bump.txt");
}
else {
 file_put_contents("bump.txt", "bump");
}

if ($evilness == "bump") {
 $error = "bump exists";
}
else {
 $error = "What the heck are you doing?";
}
?>
<!DOCTYPE html>
<html>
<head>
<title>Bump</title>
</head>
<body>
<?php
if (isset($error)) {
 echo $error;
}
else {
 echo "Need to set error as something now.";
}
?>
</body>
</html>
Title: The Bumpy Thread
Post by: CK9 on May 15, 2012, 08:55:57 PM
...how can the file be neither bump nor not bump?
Title: The Bumpy Thread
Post by: Venera on May 15, 2012, 09:10:46 PM
what the bump are you asking?
Title: The Bumpy Thread
Post by: CK9 on May 16, 2012, 07:54:30 AM
Quote
Code: [Select]
...
if ($evilness == "bump") {
 $error = "bump exists";
}
elseif ($evilness != "bump") {
 $error = "FIX YOUR DANG FILE";
}
else {
 $error = "What the heck are you doing?";
}
...

you're implying that it is posible for it to be bump but not bump at the same time with this statement
Title: The Bumpy Thread
Post by: Spikerocks101 on May 16, 2012, 10:14:09 AM
HERE I AM! ROCK YOU LIKE A BUMPACANE!
Title: The Bumpy Thread
Post by: Venera on May 17, 2012, 04:26:21 AM
Quote
Quote
Code: [Select]
...
if ($evilness == "bump") {
 $error = "bump exists";
}
elseif ($evilness != "bump") {
 $error = "FIX YOUR DANG FILE";
}
else {
 $error = "What the heck are you doing?";
}
...

you're implying that it is posible for it to be bump but not bump at the same time with this statement
Oops.  Wasn't paying attention. :P

Code: [Select]
<?php
$errortext = "";

if (isset($_POST['bumpbutton'])) {
 $errortext = "bump";
}
?>
<!DOCTYPE html>
<head>
<title>Random code</title>
</head>
<body>
<?php echo $errortext; ?>
<br />
<br />
<form action="bump.php" method="POST">
Press the button: <input type="submit" name="bumpbutton" value="Bumpy button" />
</form>
</body>
</html>
Title: The Bumpy Thread
Post by: Flashy on May 17, 2012, 06:38:23 AM
01100010 01110101 01101101 01110000
Title: The Bumpy Thread
Post by: CK9 on May 17, 2012, 08:39:39 AM
exbumpinate!
Title: The Bumpy Thread
Post by: Spikerocks101 on May 17, 2012, 09:22:00 AM
ßump
Title: The Bumpy Thread
Post by: Venera on May 20, 2012, 05:29:03 AM
ca067828db296cce4c1bb77105ee87ba8f8f77f1

sha1
Title: The Bumpy Thread
Post by: CK9 on May 21, 2012, 04:47:26 PM
Now that's a bump I don't quite get...
Title: The Bumpy Thread
Post by: Venera on May 21, 2012, 06:48:50 PM
It's the word bump hashed into sha1.

b



























u











mp
Title: The Bumpy Thread
Post by: zhukant on May 21, 2012, 10:03:19 PM
БАМП!
Title: The Bumpy Thread
Post by: CK9 on May 22, 2012, 03:15:58 PM
Russian bump?
Title: The Bumpy Thread
Post by: Venera on May 22, 2012, 06:43:14 PM
bump
Title: The Bumpy Thread
Post by: Spikerocks101 on May 22, 2012, 09:07:50 PM
qumd
Title: The Bumpy Thread
Post by: CK9 on May 23, 2012, 03:19:38 PM
when you bump, the letters are important.  Otherwise, you might dump
Title: The Bumpy Thread
Post by: Venera on May 23, 2012, 07:15:55 PM
Bump.
Title: The Bumpy Thread
Post by: Spikerocks101 on May 23, 2012, 09:23:03 PM
cvnq
Title: The Bumpy Thread
Post by: Venera on May 24, 2012, 04:10:52 AM
bump
Title: The Bumpy Thread
Post by: CK9 on May 24, 2012, 01:45:51 PM
g7j0
d5g8
a3d6

bump
Title: The Bumpy Thread
Post by: Venera on May 25, 2012, 03:52:51 PM
bump
Title: The Bumpy Thread
Post by: Spikerocks101 on May 27, 2012, 09:30:53 PM
(e-c)+(h+n)+(q-d)+(z-k)
Title: The Bumpy Thread
Post by: Venera on May 28, 2012, 04:18:31 AM
Quote
(e-c)+(h+n)+(q-d)+(z-k)
Interesting.

bump
Title: The Bumpy Thread
Post by: Flashy on May 30, 2012, 01:34:11 PM
I'llleaveabumphere
Title: The Bumpy Thread
Post by: Venera on May 30, 2012, 03:25:31 PM
I'll put an bump over there for good measure.
Title: The Bumpy Thread
Post by: Spikerocks101 on May 30, 2012, 08:44:43 PM
Batman uses magic pistol
Title: The Bumpy Thread
Post by: Venera on May 30, 2012, 08:50:00 PM
bump

no one talks on spark anymore :\
Title: The Bumpy Thread
Post by: CK9 on May 31, 2012, 12:20:47 PM
bump

I tried the other day....Arklon was on...but he didn't say hi...and then he quickly set his status to away :(
Title: The Bumpy Thread
Post by: Venera on May 31, 2012, 12:44:14 PM
bump

:\
 
Title: The Bumpy Thread
Post by: CK9 on May 31, 2012, 03:14:51 PM
bump
Title: The Bumpy Thread
Post by: Venera on May 31, 2012, 04:30:39 PM
bump
Title: The Bumpy Thread
Post by: CK9 on May 31, 2012, 05:24:02 PM
almost to 80 bump
Title: The Bumpy Thread
Post by: Venera on May 31, 2012, 06:25:23 PM
BUMP!!!!!!!!!!!
Title: The Bumpy Thread
Post by: Spikerocks101 on May 31, 2012, 08:34:53 PM
BIG ULTRA MEGA 80's PARTY!
Title: The Bumpy Thread
Post by: Venera on May 31, 2012, 09:50:22 PM
lol

bump
Title: The Bumpy Thread
Post by: CK9 on June 01, 2012, 10:32:32 AM
Who will end up with the 80'th page bump?
Title: The Bumpy Thread
Post by: Venera on June 01, 2012, 10:43:12 AM
not me
bump
Title: The Bumpy Thread
Post by: Spikerocks101 on June 01, 2012, 11:02:04 AM
This is bump 22 on page 79. Bump 24 will be the last bump on this page ( 2 bumps from now) and bump 25 will then become bump 1 on page 80. Exciting.
Title: The Bumpy Thread
Post by: Venera on June 01, 2012, 01:09:57 PM
again, not me
bump
Title: The Bumpy Thread
Post by: CK9 on June 01, 2012, 02:05:32 PM
or bump it?
Title: The Bumpy Thread
Post by: Venera on June 01, 2012, 02:27:19 PM
me?
bump
Title: The Bumpy Thread
Post by: CK9 on June 01, 2012, 03:23:12 PM
And subbed wins a bumpy cookie*



*bumy cookies contain no nutritional value.  Should swelling occur after touching bumpy cookie, please consulot a physician.  If loss of hair occurs after consuming bumpy cookie, consult a priest/rabbi/your religion's equivilant
Title: The Bumpy Thread
Post by: Venera on June 01, 2012, 05:41:34 PM
lol

bump
Title: The Bumpy Thread
Post by: Spikerocks101 on June 01, 2012, 11:17:46 PM
20 bumps till 81 party!!!!
Title: The Bumpy Thread
Post by: Venera on June 02, 2012, 06:28:13 AM
Invite only? :P

bump
Title: The Bumpy Thread
Post by: CK9 on June 02, 2012, 10:20:37 PM
forever a bump
Title: The Bumpy Thread
Post by: Venera on June 03, 2012, 05:41:58 AM
bump
Title: The Bumpy Thread
Post by: Spikerocks101 on June 03, 2012, 06:30:06 AM
bump
Title: The Bumpy Thread
Post by: Venera on June 03, 2012, 12:39:10 PM
bump
Title: The Bumpy Thread
Post by: Spikerocks101 on June 03, 2012, 08:53:40 PM
B |_| |'|'| P
Title: The Bumpy Thread
Post by: Venera on June 03, 2012, 09:14:08 PM
bump
Title: The Bumpy Thread
Post by: CK9 on June 04, 2012, 05:04:14 PM
bump?
Title: The Bumpy Thread
Post by: Venera on June 04, 2012, 05:48:41 PM
bump!
Title: The Bumpy Thread
Post by: Spikerocks101 on June 05, 2012, 12:49:11 AM
You are in a dark room
>light torch
Your torch is now lit
>look around
You see writing on the wall
>look at writing
It says "BUMP!"
>gtfo
You run away like a coward
Title: The Bumpy Thread
Post by: Venera on June 05, 2012, 08:16:38 AM
LOL

bump
Title: The Bumpy Thread
Post by: Lukc on June 05, 2012, 09:41:50 AM
*concentrates*



*continues concentrating*



*** BUMP ***
 
Title: The Bumpy Thread
Post by: Flashy on June 05, 2012, 09:58:32 AM
Nice to see that this thread has come so far. 80 is a pretty big number.

...


Also, bump.
Title: The Bumpy Thread
Post by: Venera on June 05, 2012, 10:12:14 AM
Beethoven's 5th symphony

Bump bump bump bummmmp
Title: The Bumpy Thread
Post by: Lukc on June 05, 2012, 10:31:29 AM
For the sake of bumping!
Title: The Bumpy Thread
Post by: Venera on June 05, 2012, 12:41:20 PM
bump
Title: The Bumpy Thread
Post by: Lukc on June 05, 2012, 01:18:43 PM
Let’s bump.
Title: The Bumpy Thread
Post by: Spikerocks101 on June 05, 2012, 01:28:36 PM
I want to know, have you ever seen the Bump.
Title: The Bumpy Thread
Post by: Venera on June 05, 2012, 01:30:56 PM
bump
Title: The Bumpy Thread
Post by: Spikerocks101 on June 05, 2012, 09:41:46 PM
3ump
Title: The Bumpy Thread
Post by: Lukc on June 05, 2012, 10:09:59 PM
6ump
Title: The Bumpy Thread
Post by: Venera on June 06, 2012, 04:54:35 AM
bump
Title: The Bumpy Thread
Post by: Lukc on June 06, 2012, 05:44:24 AM
|3|_|/\/\|>
Title: The Bumpy Thread
Post by: Spikerocks101 on June 06, 2012, 06:35:30 AM
Code: [Select]
  _          _ _   _
|_) |  |  | |  | |_|
|_) |_|  | |  | |
Title: The Bumpy Thread
Post by: Hidiot on June 06, 2012, 08:19:26 AM
I am tempted to not consider 3ump and 6ump as legit bumps.
Quote
|3|_|/\/\|>
BUMD? Rejected!

Also, spike? Try to preview your work of art before posting and then leaving, since you have an offset problem.
Title: The Bumpy Thread
Post by: Spikerocks101 on June 06, 2012, 08:22:38 AM
I did Fast Reply, so it doesn't have a preview option, so I decided to edit it to fix the offset problem, but it is the best I was able to do. Also, I originally did "|3ump" but found just "3bump" looked better. Kinda looked like "ßump" imo.
Title: The Bumpy Thread
Post by: Lukc on June 06, 2012, 09:14:40 AM
Quote
I am tempted to not consider 3ump and 6ump as legit bumps.
Quote
|3|_|/\/\|>
BUMD? Rejected!
Hey!?

I always did my “P”s that way. :o

And Wikipedia agrees with me:
http://en.wikipedia.org/wiki/Leet#Orthography (http://en.wikipedia.org/wiki/Leet#Orthography)

And what about bum9 ?
Title: The Bumpy Thread
Post by: Venera on June 06, 2012, 01:39:48 PM
bump?
Title: The Bumpy Thread
Post by: Spikerocks101 on June 06, 2012, 05:16:33 PM
bump
Title: The Bumpy Thread
Post by: Venera on June 06, 2012, 06:29:22 PM
bump
Title: The Bumpy Thread
Post by: Spikerocks101 on June 07, 2012, 01:14:37 AM
Bump
Title: The Bumpy Thread
Post by: Venera on June 07, 2012, 07:23:18 AM
bump
Title: The Bumpy Thread
Post by: Lukc on June 07, 2012, 10:41:58 PM
Bump, “Indeed”.
Title: The Bumpy Thread
Post by: Hooman on June 08, 2012, 02:49:16 AM
Bump, "For King and Country"!
 
Title: The Bumpy Thread
Post by: Lukc on June 08, 2012, 04:50:54 AM
Make it bump, Number One.
Title: The Bumpy Thread
Post by: Venera on June 08, 2012, 07:39:49 AM
bump
Title: The Bumpy Thread
Post by: Lukc on June 08, 2012, 07:43:12 AM
Hey, you could do some bumpier bumpy bumps, ya’ know.
Title: The Bumpy Thread
Post by: Venera on June 08, 2012, 09:12:08 AM
i could
Code: [Select]
b
  u
   m
    p
   m
  u
b
Title: The Bumpy Thread
Post by: Lukc on June 08, 2012, 09:14:18 AM
I was thinking of a more cultural bump, but well, ASCII art will do.
Title: The Bumpy Thread
Post by: Venera on June 08, 2012, 01:14:38 PM
thisbumpiscultural
Title: The Bumpy Thread
Post by: Lukc on June 09, 2012, 04:28:23 AM
Well, I’m almost sure this is an absolutely a-cultural bump.
Title: The Bumpy Thread
Post by: Venera on June 09, 2012, 08:57:10 AM
thisbumpisnotcultural
Title: The Bumpy Thread
Post by: Spikerocks101 on June 10, 2012, 07:19:28 PM
bunnp
Title: The Bumpy Thread
Post by: Venera on June 10, 2012, 07:47:23 PM
Code: [Select]
b
                                     u
        m











p
Title: The Bumpy Thread
Post by: Spikerocks101 on June 11, 2012, 01:02:29 PM
bfdbfdbmfmfgmgutfdudupgp
Title: The Bumpy Thread
Post by: Venera on June 11, 2012, 02:28:27 PM
bump
Title: The Bumpy Thread
Post by: Spikerocks101 on June 11, 2012, 08:19:43 PM
bump
Title: The Bumpy Thread
Post by: CK9 on June 11, 2012, 09:42:38 PM
bump
Title: The Bumpy Thread
Post by: Lukc on June 11, 2012, 10:25:01 PM
A Big Bump Bunny.
Title: The Bumpy Thread
Post by: Venera on June 12, 2012, 07:17:52 AM
bump
Title: The Bumpy Thread
Post by: Spikerocks101 on June 14, 2012, 08:42:31 AM
B\//\/\P
Title: The Bumpy Thread
Post by: Flashy on June 15, 2012, 04:27:00 AM
I'm posting a bump in a bump thread.
Title: The Bumpy Thread
Post by: Oprime on June 15, 2012, 11:05:50 AM
I don't bump often. But when I do it's epic.
Title: The Bumpy Thread
Post by: Lukc on June 15, 2012, 12:55:15 PM
A small bump for a user, but a giant bump for the community! *applause*
Title: The Bumpy Thread
Post by: Spikerocks101 on June 15, 2012, 08:17:24 PM
Just saw a movie with my friends-bump.
Title: The Bumpy Thread
Post by: Bonk on June 16, 2012, 05:50:06 AM
What is the most efficient way to bump this thread?
Title: The Bumpy Thread
Post by: Spikerocks101 on June 16, 2012, 08:34:04 AM
Incoming meteor. Your colony is bumped.
Title: The Bumpy Thread
Post by: Lukc on June 16, 2012, 11:37:57 AM
Don’t you have bump-defenses?
Title: The Bumpy Thread
Post by: Venera on June 17, 2012, 08:14:58 AM
bump
Title: The Bumpy Thread
Post by: Lukc on June 17, 2012, 11:21:13 AM
Bump it is, then.
Title: The Bumpy Thread
Post by: Spikerocks101 on June 17, 2012, 09:08:41 PM
bump
Title: The Bumpy Thread
Post by: Lukc on June 18, 2012, 05:04:25 AM
Bump, again and again and again and again and…
Title: The Bumpy Thread
Post by: Flashy on June 18, 2012, 11:26:56 AM
Just here I'll dump
A little bit of a bump.

Out of ideas.
Title: The Bumpy Thread
Post by: Lukc on June 19, 2012, 03:00:15 AM
“Prepare for hyperspace bump!”
Title: The Bumpy Thread
Post by: Venera on June 19, 2012, 08:50:05 AM
bump
Title: The Bumpy Thread
Post by: Lukc on June 20, 2012, 12:08:15 AM
Yet Another Bump.
Title: The Bumpy Thread
Post by: Flashy on June 20, 2012, 09:16:27 AM
Successful bunmp.
Title: The Bumpy Thread
Post by: Spikerocks101 on June 20, 2012, 10:01:08 AM
BUMP! DON'T STOP! BUMP!!!!!!
Title: The Bumpy Thread
Post by: Venera on June 20, 2012, 01:47:52 PM
BUMP
Title: The Bumpy Thread
Post by: Lukc on June 21, 2012, 11:38:46 AM
This was a *critical* bump.
Title: The Bumpy Thread
Post by: Flashy on June 26, 2012, 09:13:21 AM
*cough*
Bump.
Title: The Bumpy Thread
Post by: Lugia3 on June 26, 2012, 09:30:57 AM
Beam me up, Bump!
Title: The Bumpy Thread
Post by: Venera on June 28, 2012, 04:26:18 AM
bump
Title: The Bumpy Thread
Post by: Spikerocks101 on June 28, 2012, 12:50:13 PM
bump
Title: The Bumpy Thread
Post by: Venera on June 29, 2012, 08:04:30 PM
bump
Title: The Bumpy Thread
Post by: Flashy on July 05, 2012, 04:21:29 AM
bump
Title: The Bumpy Thread
Post by: Lugia3 on July 08, 2012, 05:06:44 PM
bump .45

That awkward moment when you make a double-shout referencing an insider joke about yourself, and don't realize you made a spelling error until after it is sent; All ye grammar Nazis!
Title: The Bumpy Thread
Post by: Flashy on July 09, 2012, 04:11:59 AM
I have no idea how to bump
Title: The Bumpy Thread
Post by: Lukc on July 10, 2012, 02:19:27 AM
Well, to bump, you should bump the bump out of the bump in bumping order. Bumpy, right?
Title: The Bumpy Thread
Post by: Flashy on July 10, 2012, 02:38:23 AM
Bump.
Title: The Bumpy Thread
Post by: Venera on July 14, 2012, 03:53:31 PM
Bump
Title: The Bumpy Thread
Post by: Flashy on July 15, 2012, 06:00:23 PM
I wonder if you can post in the bump thread without bumping, I mean, it's its whole purpose.
Title: The Bumpy Thread
Post by: Spikerocks101 on July 15, 2012, 08:58:49 PM
If there is a comment on the Bump thread, and no one looked at it, how can we tell if it has the word bump in it or not?
Title: The Bumpy Thread
Post by: Flashy on July 16, 2012, 03:37:22 AM
It's Schrödinger's bump.
Title: The Bumpy Thread
Post by: Venera on July 16, 2012, 07:05:38 AM
The Big Bump Theory.
Title: The Bumpy Thread
Post by: Flashy on July 16, 2012, 02:44:27 PM
Well, the thread indeed started with a big bump, so...
Title: The Bumpy Thread
Post by: Savant_Ace on July 16, 2012, 07:27:05 PM
Ah, the good old bump thread...
Title: The Bumpy Thread
Post by: Spikerocks101 on July 16, 2012, 09:46:06 PM
Old thread, new bump.
Title: The Bumpy Thread
Post by: zhukant on July 17, 2012, 03:35:15 PM
I can't believe OPU is still bumping along! I wonder if the IRC still works…
Title: The Bumpy Thread
Post by: Flashy on July 18, 2012, 03:18:30 AM
Will continue bumping. And I have to say, I lost track of what chat protocol OPU is using right now. This might be the reason why I never show up.
Title: The Bumpy Thread
Post by: Spikerocks101 on July 18, 2012, 09:59:45 AM
IRC got replaced with XXMP (which I don't really go on, so I am unsure if it is still active). BUMP?
Title: The Bumpy Thread
Post by: Venera on July 18, 2012, 01:44:31 PM
I stopped going on it and stopped playing cause I got way too busy.  (I should be on tomorrow if anyone wants to play.

Bumpthoven's 9th marching band.
 
Title: The Bumpy Thread
Post by: Savant_Ace on July 18, 2012, 07:40:20 PM
Cold Drink, Hot Bump.
 
Title: The Bumpy Thread
Post by: TH300 on July 19, 2012, 02:42:59 PM
Its interesting how every one is bumping here, but no one is playing op2.
Title: The Bumpy Thread
Post by: Savant_Ace on July 19, 2012, 05:43:18 PM
I'm bumping playing Outpost 2.
Title: The Bumpy Thread
Post by: Venera on July 19, 2012, 07:12:53 PM
Sorry I couldn't get on.  I was on earlier when you were on the chat TH300 but after I said brb the internet and phone went down.

bump
Title: The Bumpy Thread
Post by: Flashy on July 20, 2012, 09:12:59 AM
Maybe I should think about trying to obtain Spark.

Oh, and bump.
Title: The Bumpy Thread
Post by: TH300 on July 21, 2012, 12:33:04 AM
I blame no one - I'm not different. I'm just finding it interesting.

bump
Title: The Bumpy Thread
Post by: Venera on July 22, 2012, 10:31:27 PM
BUMP
Title: The Bumpy Thread
Post by: Spikerocks101 on July 23, 2012, 10:24:27 AM
BBBUUUMMMPPP

M4 Sherman!
Title: The Bumpy Thread
Post by: Freeza-CII on July 23, 2012, 01:47:45 PM
Bump 2000 replies
Title: The Bumpy Thread
Post by: Venera on July 23, 2012, 02:30:17 PM
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
UUUUUUUUUUUUUUUUUUUUUUUUUUUUUU
MMMMMMMMMMMMMMMMMMMMMMMMMM
PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP
Title: The Bumpy Thread
Post by: Savant_Ace on July 24, 2012, 03:00:41 PM
A bumpless production of bumping bumpers whos sole bump in life is to bumping bump the bump out of other bumpers bumpings in order to bumping bumpity bump bumpable bumpature.  
Title: The Bumpy Thread
Post by: Venera on July 24, 2012, 07:09:08 PM
Uhhhh Yes!

bump
Title: The Bumpy Thread
Post by: Flashy on July 26, 2012, 02:13:56 AM
Bump
Title: The Bumpy Thread
Post by: Venera on July 27, 2012, 03:09:23 PM
bump
Title: The Bumpy Thread
Post by: Savant_Ace on July 28, 2012, 05:40:57 AM
It just....so bumping beautfiul....-tear-...-sniff, sniff-
Title: The Bumpy Thread
Post by: Venera on July 28, 2012, 06:12:18 AM
bump
Title: The Bumpy Thread
Post by: Spikerocks101 on August 01, 2012, 07:17:52 AM
Ctrl+S Bump
Title: The Bumpy Thread
Post by: Freeza-CII on August 02, 2012, 05:06:03 AM
So is this it? the major activity is this BUMP?
Title: The Bumpy Thread
Post by: Venera on August 02, 2012, 07:52:18 PM
bump
Title: The Bumpy Thread
Post by: CK9 on August 03, 2012, 08:02:38 AM
Away from the bumping forum for a long while and still the #1 poster...I am disappointed
Title: The Bumpy Thread
Post by: Savant_Ace on August 03, 2012, 11:17:56 AM
I find it bumping ridiculous that this bumping post is the most active bump in the entire bumping community.




......... And yet I still find myself bumping. The irony. Yes, I said it. We are all i-rons.  
Title: The Bumpy Thread
Post by: Flashy on August 07, 2012, 04:13:53 PM
Bum
+p
Title: The Bumpy Thread
Post by: Venera on August 13, 2012, 04:58:52 PM
bump
Title: The Bumpy Thread
Post by: Spikerocks101 on August 16, 2012, 06:49:31 PM
a bump for the sake of bump
Title: The Bumpy Thread
Post by: Venera on August 17, 2012, 05:58:46 AM
Code: [Select]
Bb
Uu
Mm
Pp
Title: The Bumpy Thread
Post by: Spikerocks101 on August 21, 2012, 08:38:14 PM
Tump Hump Lump But No Bump
Title: The Bumpy Thread
Post by: Flashy on August 23, 2012, 06:12:40 AM
:bump:
Title: The Bumpy Thread
Post by: Venera on August 23, 2012, 07:55:48 AM
:bump::anibump::bump::anibump:
Title: The Bumpy Thread
Post by: Flashy on August 27, 2012, 08:48:36 AM
<p>bump</p>
Title: The Bumpy Thread
Post by: Spikerocks101 on August 30, 2012, 10:37:05 AM
mp  
Title: The Bumpy Thread
Post by: Venera on August 31, 2012, 10:06:27 AM
bump
Title: The Bumpy Thread
Post by: CK9 on August 31, 2012, 05:36:42 PM
85 pages of bump on the wall, 85 pages of bump
Title: The Bumpy Thread
Post by: Spikerocks101 on August 31, 2012, 06:45:35 PM
Incoming Tactical Bumb in 3... 2... 1...
Title: The Bumpy Thread
Post by: Lukc on September 01, 2012, 03:34:05 PM
A small bump for myself, but… well… an even smaller bump for all of you. :P
Title: The Bumpy Thread
Post by: Flashy on September 04, 2012, 08:55:26 AM
Well then let's bump right off the bat.
Title: The Bumpy Thread
Post by: Savant_Ace on September 06, 2012, 10:24:10 AM
A bump on a bat? What kind of bump? What kind of bat?
Title: The Bumpy Thread
Post by: angellus on September 06, 2012, 10:34:58 AM
Oh dear, I lost my bump.
Title: The Bumpy Thread
Post by: Savant_Ace on September 06, 2012, 12:36:49 PM
They have a pill for that kind of problem.


BuMp.
Title: The Bumpy Thread
Post by: Flashy on September 06, 2012, 01:10:40 PM
They have pills against things that go bump in the night now?
Title: The Bumpy Thread
Post by: Savant_Ace on September 07, 2012, 01:40:09 PM
No, just pills for when you can't get your bump up.
Title: The Bumpy Thread
Post by: Lukc on September 07, 2012, 10:09:13 PM
Are those pills for red bumps or blue bumps?
Title: The Bumpy Thread
Post by: Flashy on September 10, 2012, 12:07:36 PM
You just have to think outside the bump
Title: The Bumpy Thread
Post by: CK9 on September 10, 2012, 05:12:54 PM
they're for the things that go bump in the night
Title: The Bumpy Thread
Post by: Spikerocks101 on September 11, 2012, 12:03:57 PM
HULK BUMP!
Title: The Bumpy Thread
Post by: Savant_Ace on September 12, 2012, 07:27:32 AM
This thread is like a disease. Horray! We're growing cancer! BuMp.
Title: The Bumpy Thread
Post by: CK9 on September 13, 2012, 04:35:46 PM
bump
Title: The Bumpy Thread
Post by: Venera on September 14, 2012, 04:01:13 AM
bump?
Title: The Bumpy Thread
Post by: Lukc on September 14, 2012, 04:01:26 AM
BUMPAAA* ! \o/

*[size=8]PAAASTAAA[/size]
Title: The Bumpy Thread
Post by: CK9 on September 14, 2012, 03:34:09 PM
How would one say "bump" in French?
Title: The Bumpy Thread
Post by: Venera on September 15, 2012, 05:24:13 AM
bump................................................
Title: The Bumpy Thread
Post by: Hooman on September 16, 2012, 12:15:57 AM
Quote
How would one say "bump" in French?
According to Google Translate:

noun
 bosse:   bump, hump, lump, dent, knob, mogul
 choc:    shock, impact, clash, collision, jar, bump
 coup:    blow, shot, coup, stroke, hit, bump
 accrochage:   hanging, coupling, engagement, clash, collision, bump
 heurt:   clash, collision, shock, bump, knock
verb
 heurter:   hit, strike, offend, bump, knock, collide with
 choquer:   shock, offend, clink, hit, bump, go against
 tamponner:   buffer, stamp, swab, dab at, bump, swob
 s'heurter:   clash, meet, collide, conflict, run into, bump

 :P
 
Title: The Bumpy Thread
Post by: Lukc on September 16, 2012, 07:56:21 AM
Quote
How would one say "bump" in French?
It could be a lot of things, and I’m not quiet sure what “bump” means here. ^_^”
Title: The Bumpy Thread
Post by: Venera on September 16, 2012, 08:29:24 AM
I would assume in some posts it's being used as a verb and in others as a noun.
Title: The Bumpy Thread
Post by: Flashy on September 16, 2012, 09:04:42 AM
A bumping day today, so I'm going to bump.
Title: The Bumpy Thread
Post by: CK9 on September 17, 2012, 08:21:11 AM
So first we must define what kind of action "bumping" a thread is...
 
Title: The Bumpy Thread
Post by: Venera on September 17, 2012, 08:45:27 PM
To bump a thread?
 
Title: The Bumpy Thread
Post by: Flashy on September 18, 2012, 05:19:03 PM
Bumping a thread is like...
Well, it's kind of like... like... um...  
Title: The Bumpy Thread
Post by: Hooman on September 19, 2012, 09:16:00 PM
"Bumping a thread" is moving it to the front of a list, such as what happens when you append a post to it, such as a simple post containing only the text "bump". Often used to gain greater attention to the thread for high traffic forums, where threads fall off the first page within minutes, and so their viewership drops quickly, even though the thread might still be current and relevant.

It would do more if there was actually some other activity in this forum.

I noticed there was a lot of thread bumping on the Runescape forums where people were buying and selling items.
 
Title: The Bumpy Thread
Post by: Freeza-CII on September 20, 2012, 04:05:23 AM
le bump <---- french bump
 
Title: The Bumpy Thread
Post by: Venera on September 20, 2012, 04:18:14 AM
bump
Title: The Bumpy Thread
Post by: Flashy on September 22, 2012, 01:23:38 PM
couldn't it be la bump as well?
Title: The Bumpy Thread
Post by: Venera on September 24, 2012, 12:58:44 PM
i don't bumping know
Title: The Bumpy Thread
Post by: Flashy on September 25, 2012, 07:43:14 AM
Well bump
Title: The Bumpy Thread
Post by: Savant_Ace on September 25, 2012, 12:21:18 PM
I think this thread is like the blight. I don't want to come here and bump, but my mouse goes here anyway and then my command center is infected and I can't not post.
Title: The Bumpy Thread
Post by: CK9 on September 25, 2012, 03:29:50 PM
you have bumped, our colony is doomed type scenario?
Title: The Bumpy Thread
Post by: Flashy on September 25, 2012, 03:35:53 PM
Oh no! Quick! To the bump-mobile! (I sure hope no one said this before)
Title: The Bumpy Thread
Post by: Spikerocks101 on September 25, 2012, 08:57:29 PM
Na na na na na na na na BUMPMAN!
Title: The Bumpy Thread
Post by: Venera on September 26, 2012, 06:52:25 AM
bump?
Title: The Bumpy Thread
Post by: Savant_Ace on September 26, 2012, 07:56:06 AM
More like "You have bumped, our colony is BUMPED."
Title: The Bumpy Thread
Post by: Deathagorn on September 26, 2012, 02:02:59 PM
bump, bu bu bump bump, bump bump!
Title: The Bumpy Thread
Post by: CK9 on September 26, 2012, 06:44:39 PM
sometimes you feel like a bump, sometimes you don't
Title: The Bumpy Thread
Post by: Spikerocks101 on September 26, 2012, 10:51:27 PM
I sometimes wake up bumpy, but sometimes I let her sleep.
Title: The Bumpy Thread
Post by: Savant_Ace on September 27, 2012, 07:43:32 AM
I wonder how many bumps are in YYZed...
Title: The Bumpy Thread
Post by: Venera on September 27, 2012, 10:24:06 AM
bump
Title: The Bumpy Thread
Post by: Flashy on September 29, 2012, 12:20:42 PM
87 pages of bump, getting there slowly
Title: The Bumpy Thread
Post by: Savant_Ace on October 01, 2012, 06:42:57 AM
Getting bumping where slowly?
Title: The Bumpy Thread
Post by: Spikerocks101 on October 01, 2012, 12:42:11 PM
To infinity bump and beyond!
Title: The Bumpy Thread
Post by: Savant_Ace on October 01, 2012, 12:59:22 PM
Can you imagine a world where nobody bumps?
Title: The Bumpy Thread
Post by: Venera on October 01, 2012, 05:58:55 PM
BUMP BUMP B UPM BUMP BUMP BUMP BUMPB MPMBBU
Title: The Bumpy Thread
Post by: Hooman on October 01, 2012, 11:33:33 PM
Can you imagine a world without hypothetical questions?

Bump.
 
Title: The Bumpy Thread
Post by: Savant_Ace on October 02, 2012, 09:18:52 AM
Hypothetically? No. Bump.
Title: The Bumpy Thread
Post by: Spikerocks101 on October 02, 2012, 03:07:01 PM
Bump thread, wat r u doin? Bump thread, stahp!
Title: The Bumpy Thread
Post by: Hooman on October 02, 2012, 11:02:07 PM
Can you imagine an imaginary menagerie manager imagining managing an imaginary menagerie?

Bump.
 
Title: The Bumpy Thread
Post by: Spikerocks101 on October 03, 2012, 01:35:26 AM
If I answer yes, do I when a bump?
Title: The Bumpy Thread
Post by: Venera on October 03, 2012, 07:11:01 AM
BUMP
Title: The Bumpy Thread
Post by: Freeza-CII on October 05, 2012, 09:51:34 AM
im going to start deleting random bumps just to f*** with every one :P
 
Title: The Bumpy Thread
Post by: Venera on October 05, 2012, 01:53:10 PM
bumplol
Title: The Bumpy Thread
Post by: Flashy on October 07, 2012, 11:25:08 AM
Bump
Title: The Bumpy Thread
Post by: CK9 on October 08, 2012, 05:13:09 PM
bum bum bum buuummmmmm


P
Title: The Bumpy Thread
Post by: Spikerocks101 on October 08, 2012, 09:04:07 PM
WHAT A BUMP!
Title: The Bumpy Thread
Post by: Venera on October 09, 2012, 07:10:25 AM
bumpity
Title: The Bumpy Thread
Post by: Savant_Ace on October 09, 2012, 10:29:21 AM
I believe this thread has been designated government maintained, based on the condition of the path. There are enough bumps to facilitate dark ages dental work just by walking down it.
Title: The Bumpy Thread
Post by: Lukc on October 10, 2012, 03:54:35 AM
Quote
I believe this thread has been designated government maintained, based on the condition of the path. There are enough bumps to facilitate dark ages dental work just by walking down it.
What the bump is he sayin’?
Title: The Bumpy Thread
Post by: Savant_Ace on October 11, 2012, 08:01:56 AM
Have you ever driven down a government maintained stretch of road? Not local municipal but actually fedral maintained? You may as well go off roading, the ride with be smoother and contain less bumps.
Title: The Bumpy Thread
Post by: Lukc on October 11, 2012, 10:20:29 AM
What the…? Well, let’s bump something else.
Title: The Bumpy Thread
Post by: Savant_Ace on October 11, 2012, 01:02:10 PM
No thanks, I'm not into bumping objects. But thanks.
Title: The Bumpy Thread
Post by: Venera on October 11, 2012, 01:27:43 PM
BuMp
Title: The Bumpy Thread
Post by: Spikerocks101 on October 11, 2012, 01:44:54 PM
MELP HELP NUKE BUMP!
Title: The Bumpy Thread
Post by: Flashy on October 11, 2012, 02:14:40 PM
Bump
Title: The Bumpy Thread
Post by: Lukc on October 11, 2012, 02:22:24 PM
Bumping until the end of times.
Title: The Bumpy Thread
Post by: Flashy on October 11, 2012, 02:47:13 PM
Indeed.

...



I meant, bump.
Title: The Bumpy Thread
Post by: Lukc on October 12, 2012, 12:12:58 AM
go’i

Right now, that means “bump” too. (or something close)
Title: The Bumpy Thread
Post by: Spikerocks101 on October 14, 2012, 07:14:19 AM
2 day bump
Title: The Bumpy Thread
Post by: Flashy on October 14, 2012, 08:07:02 AM
Less than a day bump
Title: The Bumpy Thread
Post by: Lukc on October 14, 2012, 11:34:32 AM
“As fast as I could” bump.
Title: The Bumpy Thread
Post by: Spikerocks101 on October 15, 2012, 08:55:00 PM
McBump©
Title: The Bumpy Thread
Post by: Savant_Ace on October 17, 2012, 06:59:53 AM
Thats not good. When did the McDonalds franchise purchase a portion of this threads BumPs?
Title: The Bumpy Thread
Post by: Flashy on October 17, 2012, 08:32:31 AM
I'd like a McBump and a strawberry smoothie please.
Title: The Bumpy Thread
Post by: Spikerocks101 on October 18, 2012, 06:49:42 PM
Pumb
Title: The Bumpy Thread
Post by: CK9 on October 19, 2012, 10:22:30 AM
How many bumps must a man type out, before you call him a man?
Title: The Bumpy Thread
Post by: Spikerocks101 on October 19, 2012, 11:40:29 AM
The answer my friend, it bumping in the wind. The answer is bumping in the wind.
Title: The Bumpy Thread
Post by: Lukc on October 20, 2012, 07:24:06 AM
This is the day I’m lazy. I will content myself of a plain, simple bump.
Title: The Bumpy Thread
Post by: Spikerocks101 on October 21, 2012, 01:48:04 PM
Sir Bumpapopalypse
Title: The Bumpy Thread
Post by: Flashy on October 21, 2012, 04:47:32 PM
Off to Bumpington Lakeside.
Title: The Bumpy Thread
Post by: CK9 on October 22, 2012, 08:24:21 AM
bumparea
Title: The Bumpy Thread
Post by: Lukc on October 22, 2012, 08:32:13 AM
BUMPAAA. \o/
Title: The Bumpy Thread
Post by: Venera on October 22, 2012, 12:52:50 PM
bumpmub
Title: The Bumpy Thread
Post by: CK9 on October 22, 2012, 02:26:58 PM
qmudbump
Title: The Bumpy Thread
Post by: Hidiot on October 22, 2012, 06:43:33 PM
Inconspicuous bump
Title: The Bumpy Thread
Post by: Lukc on October 23, 2012, 12:47:48 AM
OBJECTION, your honor! This wasn’t a fair bump.
Title: The Bumpy Thread
Post by: Hidiot on October 23, 2012, 01:29:13 AM
Quote
:huh:

Rules:

    * Your post MUST have bump in it
    * You may not bump twice in a row
    * It doesn't matter how you bump, so long as you bump

/me bumps

<_<
Your objection falls flat, I respected all the rules of bumping.
Title: The Bumpy Thread
Post by: Flashy on October 23, 2012, 03:56:28 AM
Very conspicuous bump
Title: The Bumpy Thread
Post by: Savant_Ace on October 23, 2012, 08:43:45 AM
Bump him! Him and the bump he rode in on!
Title: The Bumpy Thread
Post by: Spikerocks101 on October 23, 2012, 11:21:56 AM
There is a secret bump hidden in this message.
Title: The Bumpy Thread
Post by: Venera on October 23, 2012, 12:17:12 PM
p
m
u
b
Title: The Bumpy Thread
Post by: CK9 on October 23, 2012, 01:41:48 PM
is a bump still a bump if you spread it out over multiple posts?
Title: The Bumpy Thread
Post by: Venera on October 23, 2012, 02:07:16 PM
b      
Title: The Bumpy Thread
Post by: Hidiot on October 23, 2012, 11:20:38 PM
CK9, no, it clearly states that A post MUST contain a bump in it.
Title: The Bumpy Thread
Post by: CK9 on October 24, 2012, 12:52:58 AM
no, it says Your post MUST have bump in it, not A post :P
Title: The Bumpy Thread
Post by: Spikerocks101 on October 24, 2012, 01:10:17 AM
Mine says "Keep bump away from small children age 8 and under".
Title: The Bumpy Thread
Post by: Lukc on October 24, 2012, 04:12:36 AM
Well, the rule should tell the bump must be readable by a human being without having to read the source of the forum’s page, then. ]:->
Title: The Bumpy Thread
Post by: Venera on October 24, 2012, 07:11:12 AM
I like the bumping source code though.
Title: The Bumpy Thread
Post by: Lukc on October 24, 2012, 07:46:47 AM
Well, the source code isn’t that bumpy, to be honest. It’s PHP-generated code, so, well… what could you expect?
Title: The Bumpy Thread
Post by: CK9 on October 24, 2012, 02:21:36 PM
Code: [Select]
local function bump(...)
local duration = {...}
for i=1,duration do
print("bump")
end
end
Title: The Bumpy Thread
Post by: Spikerocks101 on October 25, 2012, 03:43:28 AM
void Bump() {print("Bump!");}
Title: The Bumpy Thread
Post by: Lukc on October 25, 2012, 04:17:16 AM
Quote
Code: [Select]
local function bump(...)
local duration = {...}
for i=1,duration do
print("bump")
end
end
Actually, I would have written it that way:

Code: [Select]
local bump = function(duration)
    for i = 1,duration do
        print("bump")
    end
end
Title: The Bumpy Thread
Post by: CK9 on October 25, 2012, 08:26:26 AM
I just wanted a longer bump code :P
Title: The Bumpy Thread
Post by: Spikerocks101 on October 25, 2012, 08:11:06 PM
BUMP!
Title: The Bumpy Thread
Post by: CK9 on October 25, 2012, 11:39:34 PM
bump
Title: The Bumpy Thread
Post by: Flashy on October 26, 2012, 08:33:02 AM
Imma bump
Title: The Bumpy Thread
Post by: Venera on October 26, 2012, 08:33:52 AM
outpost 3: the bump
Title: The Bumpy Thread
Post by: Lukc on October 26, 2012, 11:29:48 AM
Quote
I just wanted a longer bump code :P
In that case,

Code: [Select]
local function bump(...)
   local duration = ...
   for i=1,#duration do
      print("bump")
   end
end

… might be a bit more (totally) valid. :D Though if you wanted longer code, I guess you could have tried recursivity using a function local to the already-local bump(...) function. (:D)
Title: The Bumpy Thread
Post by: Flashy on October 26, 2012, 02:03:03 PM
Quote
outpost 3: the bump
Outpost 2: Divided bump. No, we already had that one.
Title: The Bumpy Thread
Post by: CK9 on October 26, 2012, 07:15:14 PM
Divided bump, eh?
..._
...\/ ...<-- it's a wedge
bump
..._
bu\/mp

bu   mp
Title: The Bumpy Thread
Post by: Spikerocks101 on October 26, 2012, 09:25:56 PM
Bat Hump
Title: The Bumpy Thread
Post by: CK9 on October 27, 2012, 10:54:33 AM
O.O  what the bump?
Title: The Bumpy Thread
Post by: Lukc on October 27, 2012, 11:18:52 AM
Is this Not Another Bump?
Title: The Bumpy Thread
Post by: CK9 on October 27, 2012, 11:36:30 AM
10 more pages of bump to go
Title: The Bumpy Thread
Post by: Lukc on October 27, 2012, 11:47:26 AM
Well, you bumped for 90 pages, what are 10 pages more?
Title: The Bumpy Thread
Post by: CK9 on October 27, 2012, 04:39:42 PM
Don't you know that the final stretch of bumps is always the hardest?
Title: The Bumpy Thread
Post by: Lukc on October 27, 2012, 11:04:51 PM
It never ends, therefor there is no final stretch of bumps, therefor the question is irrelevant.

:D
Title: The Bumpy Thread
Post by: CK9 on October 28, 2012, 02:05:35 AM
100 pages of bump is taking so long, reaching it will be enough for most of us, lol
Title: The Bumpy Thread
Post by: Lukc on October 28, 2012, 05:34:32 AM
Well, “long” is relative. If you bump without thinking about the page number, it’ll be a lot faster. \o/ (and we may not notice once we’re over 100 \o/)
Title: The Bumpy Thread
Post by: CK9 on October 28, 2012, 11:03:55 AM
you don't find over 7 years for 100 pages of posts that are bumps a long time?
Title: The Bumpy Thread
Post by: Lukc on October 28, 2012, 11:24:29 AM
“Time is relative”, and so is the number of bumps. So, considering the size of OPU, not really. :P
Title: The Bumpy Thread
Post by: Flashy on October 28, 2012, 11:34:15 AM
Personally I'm honored to be contributing to this 7-year long bump.

Oh yes, there are just 10 pages left, soon we'll be breaking the bump barrier.
Title: The Bumpy Thread
Post by: Lukc on October 28, 2012, 11:44:42 AM
I wouldn’t even have been able to bump, seven years ago. /o\
Title: The Bumpy Thread
Post by: CK9 on October 28, 2012, 04:22:50 PM
I just wish that all our bumpers were bumping on the 100th page :/
Title: The Bumpy Thread
Post by: Lukc on October 29, 2012, 02:32:04 AM
Considering I never knew some of those bumpers… yeah. /o\
Title: The Bumpy Thread
Post by: Spikerocks101 on October 29, 2012, 03:38:36 AM
Speed Bump is Speedy.
Title: The Bumpy Thread
Post by: Lukc on October 29, 2012, 03:48:49 AM
Indeed. [bump]
Title: The Bumpy Thread
Post by: Venera on October 29, 2012, 08:14:22 AM
bumpycraft
Title: The Bumpy Thread
Post by: Lukc on October 29, 2012, 08:49:37 AM
*bumpcraft?
Title: The Bumpy Thread
Post by: Venera on October 29, 2012, 09:04:35 AM
no. bumpycraft
Title: The Bumpy Thread
Post by: Lukc on October 29, 2012, 09:05:32 AM
So, what’s “bumpycraft”? /o\
Title: The Bumpy Thread
Post by: Venera on October 29, 2012, 09:09:20 AM
bumpycraft is the name of a minecraft mod that i am imagining.
Title: The Bumpy Thread
Post by: Lukc on October 29, 2012, 09:42:30 AM
Erf, I see. So, what’s going to be bumpy about it?
Title: The Bumpy Thread
Post by: Flashy on October 29, 2012, 12:35:23 PM
Running low on bumps
Title: The Bumpy Thread
Post by: Venera on October 29, 2012, 02:22:03 PM
i don't know what will be bumpy
Title: The Bumpy Thread
Post by: CK9 on October 29, 2012, 08:54:41 PM
bump
Title: The Bumpy Thread
Post by: Lukc on October 30, 2012, 12:07:10 AM
So, why is it called bumpycraft if it’s not bumpy?
Title: The Bumpy Thread
Post by: Flashy on October 30, 2012, 06:54:27 AM
bûmp?
Title: The Bumpy Thread
Post by: Lukc on October 30, 2012, 08:26:25 AM
Bǔmp!
Title: The Bumpy Thread
Post by: Venera on October 30, 2012, 11:07:47 AM
why not?

bump
Title: The Bumpy Thread
Post by: CK9 on October 30, 2012, 11:46:03 AM
bump
Title: The Bumpy Thread
Post by: Venera on October 30, 2012, 01:30:49 PM
windows 8: full of bumps!
Title: The Bumpy Thread
Post by: CK9 on October 30, 2012, 08:59:40 PM
I think that picture lock thing is a bumping interesting idea
Title: The Bumpy Thread
Post by: Lukc on October 31, 2012, 01:33:50 AM
I think Windows, whatever the pseudo-version number, will still be a bumpy s***. Ever. No exceptions.
Title: The Bumpy Thread
Post by: Venera on October 31, 2012, 08:16:06 AM
that's because it's bumping microsoft.
Title: The Bumpy Thread
Post by: Lukc on October 31, 2012, 08:18:40 AM
That’s because it’s bumpy closed-source software. :)
Title: The Bumpy Thread
Post by: Flashy on October 31, 2012, 09:08:38 AM
Bump?

Bump.
Title: The Bumpy Thread
Post by: Lukc on October 31, 2012, 09:49:04 AM
Bũmp.
Title: The Bumpy Thread
Post by: Venera on October 31, 2012, 10:16:34 AM
BCI

Bump Corps International
Title: The Bumpy Thread
Post by: Lukc on October 31, 2012, 10:31:58 AM
Búmp.
Title: The Bumpy Thread
Post by: Flashy on October 31, 2012, 02:11:49 PM
Bùmp
Title: The Bumpy Thread
Post by: Lugia3 on October 31, 2012, 03:15:33 PM
pumB
Title: The Bumpy Thread
Post by: Lukc on November 01, 2012, 03:56:05 AM
Būmp.
Title: The Bumpy Thread
Post by: Flashy on November 01, 2012, 05:46:56 AM
Bµmp
Title: The Bumpy Thread
Post by: Venera on November 01, 2012, 07:14:43 AM
ßump

 
Title: The Bumpy Thread
Post by: Flashy on November 01, 2012, 08:40:50 AM
Um... bump? No, more like....
...
I got nothing.
Title: The Bumpy Thread
Post by: Venera on November 01, 2012, 06:03:49 PM
Bump
Title: The Bumpy Thread
Post by: Flashy on November 01, 2012, 06:45:23 PM
By "I got nothing" I meant that my
understanding of the subject lacked the
mere knowledge of a
proper phrase to use

Yes.
Title: The Bumpy Thread
Post by: Hidiot on November 01, 2012, 09:59:44 PM
You could have made that post a little bit less obvious.
Title: The Bumpy Thread
Post by: Lukc on November 02, 2012, 07:00:03 AM
Bũmp? \o/
Title: The Bumpy Thread
Post by: Flashy on November 02, 2012, 08:58:29 AM
It's like that because I was afraid someone wouldn't get it.

Quote
/me bumps
Title: The Bumpy Thread
Post by: Venera on November 02, 2012, 09:04:01 AM
I see what you did there! :o

bumppp
Title: The Bumpy Thread
Post by: Lukc on November 02, 2012, 01:12:53 PM
I didn’t. Bűmp anyway.
Title: The Bumpy Thread
Post by: Venera on November 02, 2012, 06:52:25 PM
BUMP bump BUMP bump BUMP bump
Title: The Bumpy Thread
Post by: Flashy on November 03, 2012, 03:52:50 AM
Traditional bump
Title: The Bumpy Thread
Post by: Lukc on November 03, 2012, 06:10:51 AM
Bůmp.
Title: The Bumpy Thread
Post by: Flashy on November 03, 2012, 04:08:06 PM
Bomb. No, I meant bump.
Title: The Bumpy Thread
Post by: Lukc on November 03, 2012, 04:56:35 PM
Buḿp. \o/ (I have a lot of them, don’t worry about it :P)
Title: The Bumpy Thread
Post by: Flashy on November 03, 2012, 05:54:49 PM
Bump.
Because I'm too lazy to look that up.
Title: The Bumpy Thread
Post by: Venera on November 03, 2012, 07:14:42 PM
BumÞ
Title: The Bumpy Thread
Post by: Flashy on November 03, 2012, 07:40:41 PM
No seriously, I'm too lazy to look that bump up
Title: The Bumpy Thread
Post by: Lukc on November 04, 2012, 06:23:31 AM
Bumṕ.
Title: The Bumpy Thread
Post by: Venera on November 04, 2012, 07:03:57 AM
Bum¶
Title: The Bumpy Thread
Post by: Lukc on November 04, 2012, 08:29:31 AM
Ɓump.
Title: The Bumpy Thread
Post by: Venera on November 04, 2012, 10:50:31 AM
ВЦМР
 
Title: The Bumpy Thread
Post by: CK9 on November 04, 2012, 09:41:01 PM
That bump looks like blimp, lol
Title: The Bumpy Thread
Post by: Lukc on November 04, 2012, 11:31:48 PM
Bümp.
Title: The Bumpy Thread
Post by: Venera on November 05, 2012, 08:13:29 AM
BuMp
Title: The Bumpy Thread
Post by: Lukc on November 05, 2012, 01:16:25 PM
That was easy. Bumþ.
Title: The Bumpy Thread
Post by: Venera on November 05, 2012, 09:41:13 PM
Quote
BumÞ
quotable bump strikes again!
Title: The Bumpy Thread
Post by: Lukc on November 06, 2012, 12:40:52 AM
:o

Bümp? (I’m not sure I didn’t already used it, tbh)
Title: The Bumpy Thread
Post by: Flashy on November 06, 2012, 06:43:28 AM
Quote
Bümp.
Title: The Bumpy Thread
Post by: Venera on November 06, 2012, 08:19:45 AM
xgml

This is typed bump on a QWERTY keyboard using the Dvorak layout.
Title: The Bumpy Thread
Post by: Lukc on November 06, 2012, 09:34:24 AM
True enough. I should have used Bűmp, then. /o\

Also, kvqj. This is a typed bump on a qwerty keyboard using the bépo layout. :P
Title: The Bumpy Thread
Post by: Flashy on November 06, 2012, 12:57:02 PM
I see the bumping is progressing quite good, we're on page 93.
Title: The Bumpy Thread
Post by: Venera on November 06, 2012, 01:22:02 PM
bump

I can't think of anything right now. :\


EDIT:  Changed write to right.....
Title: The Bumpy Thread
Post by: Lukc on November 07, 2012, 03:17:52 AM
Quote
I see the bumping is progressing quite good, we're on page 93.
Indeed, it is.

Bymp.
Title: The Bumpy Thread
Post by: Venera on November 07, 2012, 05:29:24 AM
bump?!?!?!?!?!?!?!?!?!?!?!?
Title: The Bumpy Thread
Post by: Flashy on November 07, 2012, 08:54:30 AM
Quote
I see the bumping is progressing quite good, we're on page 93.
*quite well
Title: The Bumpy Thread
Post by: Lukc on November 07, 2012, 09:22:56 AM
My idea was similar to the “ping->pong->pung->pyng->pang->peng->ping” idea.

But, bump anyway. :P
Title: The Bumpy Thread
Post by: CK9 on November 07, 2012, 12:44:09 PM
bumping rant:

I'm so sick of hearing of people who chose not to vote here in the US because they didn't either the democratic nor the republican candidates.  There are other parties people!  The green party alone has gained entire states in the past.  Stop falling into the trapping mindset of "a vote for a different party is a wasted vote."  If the other parties start getting more support, then the juggarnauts of the political system will start realizing they have major problems.

I'm also sick of people who vote based on the appearance of the candidates.  Just because someone looks "cute" or "nice" doesn't mean they can do the job.  Research the candidates, what they stand for, and vote for the one you agree with the most!

*steps down from his soap box and then smashes it against the wall in frustration over the improper voting practices*


Maybe there should be an exam in order to vote -.-
Title: The Bumpy Thread
Post by: Venera on November 07, 2012, 09:07:53 PM
bump
Title: The Bumpy Thread
Post by: Lukc on November 08, 2012, 04:23:05 AM
Quote
Maybe there should be an exam in order to vote -.-
So that only people in complete agreement with a particular party would get the right to vote? :D

Bump.
Title: The Bumpy Thread
Post by: Venera on November 08, 2012, 05:26:09 AM
BUmp
Title: The Bumpy Thread
Post by: Lukc on November 08, 2012, 05:34:56 AM
Bump (I am opposed against incorrect typography, even in order to make an original bump).
Title: The Bumpy Thread
Post by: Venera on November 08, 2012, 06:11:29 AM
BUMp
Too bad.
Title: The Bumpy Thread
Post by: Flashy on November 08, 2012, 06:11:42 AM
Bump
Title: The Bumpy Thread
Post by: Lukc on November 08, 2012, 06:44:29 AM
Too bad, yes. :(

Bump.
Title: The Bumpy Thread
Post by: Venera on November 08, 2012, 01:25:55 PM
bump
Title: The Bumpy Thread
Post by: Flashy on November 08, 2012, 02:44:52 PM
bump
Title: The Bumpy Thread
Post by: Venera on November 08, 2012, 07:39:34 PM
bump
Title: The Bumpy Thread
Post by: CK9 on November 08, 2012, 11:08:10 PM
Quote
Quote
Maybe there should be an exam in order to vote -.-
So that only people in complete agreement with a particular party would get the right to vote? :D

Bump.
No, so that people will actually take the time to vote for someone they agree with and not someone that "looks cute"
Title: The Bumpy Thread
Post by: Lukc on November 09, 2012, 12:56:06 AM
Quote
Quote
Quote
Maybe there should be an exam in order to vote -.-
So that only people in complete agreement with a particular party would get the right to vote? :D

Bump.
No, so that people will actually take the time to vote for someone they agree with and not someone that "looks cute"
“Education” and exams given by the government have always been a discreet way of making propaganda in the past. I fail to see how an exam to vote would be different. IMHO, in the current society, it would just make people think it would be irresponsible to vote for an alternative party instead of them thinking some party is right.

Besides, you didn’t bump. :P
Title: The Bumpy Thread
Post by: Hooman on November 09, 2012, 01:49:05 AM
Oh noes! Bumping violation detected!

We're going to have to reset this thread now.


 ;)
 
Title: The Bumpy Thread
Post by: Lukc on November 09, 2012, 01:50:18 AM
Oh noes. :D Bump.
Title: The Bumpy Thread
Post by: Hooman on November 09, 2012, 01:52:15 AM
Or I can just slowly up the number of bumps per page, thereby making page 100 more and more difficult to reach, and see how long it takes people to notice.  :whistle:  
Title: The Bumpy Thread
Post by: Lukc on November 09, 2012, 01:53:14 AM
You could do that. But, it wouldn’t be nice. :(

Bump.
Title: The Bumpy Thread
Post by: Venera on November 09, 2012, 06:12:46 AM
Quote
爆沸
buil
bosse
Stoß
πρόσκρουση
urto
隆起
융기
colisão
ремуо
topetón
bump
bump in different languages!
Title: The Bumpy Thread
Post by: Lukc on November 09, 2012, 07:20:43 AM
« bosser » isn’t a verb. I should deduce that most of your translations of “bump” are in fact erroneous or wrong.
Title: The Bumpy Thread
Post by: Hidiot on November 09, 2012, 09:10:01 AM
Quote
:huh:

Rules:

    * Your post MUST have bump in it
    * You may not bump twice in a row
    * It doesn't matter how you bump, so long as you bump

/me bumps

<_<
Sorry Hooman and Lukc, you're wrong. It just has to be somewhere in the post, and quotes are part of a post.
Title: The Bumpy Thread
Post by: Lukc on November 09, 2012, 09:28:53 AM
Hum… it’s like making inclusions, I guess. But, is what is in an include in your own source code?

Bump.
Title: The Bumpy Thread
Post by: Flashy on November 09, 2012, 10:26:24 AM
I did several quote-bumps in the past
Title: The Bumpy Thread
Post by: CK9 on November 09, 2012, 10:31:12 AM
Quote
Quote
Quote
Quote
Maybe there should be an exam in order to vote -.-
So that only people in complete agreement with a particular party would get the right to vote? :D

Bump.
No, so that people will actually take the time to vote for someone they agree with and not someone that "looks cute"
“Education” and exams given by the government have always been a discreet way of making propaganda in the past. I fail to see how an exam to vote would be different. IMHO, in the current society, it would just make people think it would be irresponsible to vote for an alternative party instead of them thinking some party is right.

Besides, you didn’t bump. :P
That's why you have multiple parties form it so that you don't get one controling a bias on it :P

and I didn't forget to bump, I hijacked your bump :P
Title: The Bumpy Thread
Post by: Lukc on November 09, 2012, 12:30:08 PM
Two parties controlling education isn’t something unusual either. Or one doing it and the other not noticing it too. :-/ Well, anyway, I’m just not convinced exams work for anything. :P

Bump.
Title: The Bumpy Thread
Post by: Flashy on November 09, 2012, 02:14:17 PM
Quote
Quote
Quote
Quote
Quote
Maybe there should be an exam in order to vote -.-
So that only people in complete agreement with a particular party would get the right to vote? :D

Bump.
No, so that people will actually take the time to vote for someone they agree with and not someone that "looks cute"
“Education” and exams given by the government have always been a discreet way of making propaganda in the past. I fail to see how an exam to vote would be different. IMHO, in the current society, it would just make people think it would be irresponsible to vote for an alternative party instead of them thinking some party is right.

Besides, you didn’t bump. :P
That's why you have multiple parties form it so that you don't get one controling a bias on it :P

and I didn't forget to bump, I hijacked your bump :P
Does this still count as stealing
Title: The Bumpy Thread
Post by: Lukc on November 10, 2012, 12:37:57 AM
Quote
Quote
Quote
Quote
Quote
Quote
Maybe there should be an exam in order to vote -.-
So that only people in complete agreement with a particular party would get the right to vote? :D

Bump.
No, so that people will actually take the time to vote for someone they agree with and not someone that "looks cute"
“Education” and exams given by the government have always been a discreet way of making propaganda in the past. I fail to see how an exam to vote would be different. IMHO, in the current society, it would just make people think it would be irresponsible to vote for an alternative party instead of them thinking some party is right.

Besides, you didn’t bump. :P
That's why you have multiple parties form it so that you don't get one controling a bias on it :P

and I didn't forget to bump, I hijacked your bump :P
Does this still count as stealing
Maybe we should continue this until someone complains, just to see how long it takes? :P
Title: The Bumpy Thread
Post by: Flashy on November 10, 2012, 07:58:45 AM
Bump
Title: The Bumpy Thread
Post by: Lukc on November 10, 2012, 10:08:55 AM
Bump.
Title: The Bumpy Thread
Post by: Spikerocks101 on November 11, 2012, 09:00:21 PM
Bump
Title: The Bumpy Thread
Post by: Lukc on November 12, 2012, 06:49:07 AM
Bump.
Title: The Bumpy Thread
Post by: Venera on November 12, 2012, 08:03:20 AM
Bump

Those translations aren't mine...
Title: The Bumpy Thread
Post by: Lukc on November 12, 2012, 09:08:08 AM
Bump.

I know. :P
Title: The Bumpy Thread
Post by: Venera on November 12, 2012, 08:14:52 PM
BUMP
Title: The Bumpy Thread
Post by: Lukc on November 13, 2012, 01:27:46 AM
Bump. o/ o/ o/ o/ o/
Title: The Bumpy Thread
Post by: Spikerocks101 on November 13, 2012, 11:13:35 AM
/o /o /o /o /o /o dwnq
Title: The Bumpy Thread
Post by: Lukc on November 14, 2012, 04:26:03 AM
Bump. Didn’t you just try to demonstrate w was a double-v instead of a double-u? :P
Title: The Bumpy Thread
Post by: Venera on November 14, 2012, 08:25:06 AM
BadsfaefasdfasgfUasdfasdfasgfrgadfsgfMasdfasdfafP
Title: The Bumpy Thread
Post by: Lukc on November 15, 2012, 07:29:04 AM
Bump. \o/

Hey, Hooman, I noticed. Could you please put back to normal the number of posts per page? :P
Title: The Bumpy Thread
Post by: Flashy on November 15, 2012, 10:06:25 AM
When I psoted here 5 days ago, we were on page 93, now, five days later, we're on page 91. What the bump.
Title: The Bumpy Thread
Post by: Venera on November 15, 2012, 12:33:49 PM
Why the bump would you do this!!!!! :P
Title: The Bumpy Thread
Post by: Flashy on November 15, 2012, 08:21:41 PM
Quote
When I psoted here 5 days ago, we were on page 93, now, five days later, we're on page 91. What the bump.
Apparently I'm quite proficient in "psoting". I mean, how did I miss that.
Title: The Bumpy Thread
Post by: Hooman on November 16, 2012, 05:04:39 AM
Quote
Hey, Hooman, I noticed. Could you please put back to normal the number of posts per page? 

I have no bumping idea what your talking about. It's always been 25 posts per page!  :whistle:
 
Title: The Bumpy Thread
Post by: Spikerocks101 on November 16, 2012, 03:22:52 PM
It's like the stairs before bowser in Super Mario 64, right when you think you're close, it grows! Ba-Ump.
Title: The Bumpy Thread
Post by: Hooman on November 17, 2012, 01:16:38 AM
"Shepard tone" bump. :P
 
Title: The Bumpy Thread
Post by: Flashy on November 17, 2012, 05:47:01 AM
Bump
Title: The Bumpy Thread
Post by: Spikerocks101 on November 17, 2012, 10:25:45 PM
MINUTEMAN BUMP!
Title: The Bumpy Thread
Post by: Hooman on November 18, 2012, 02:05:39 AM
small-man bump. :P
 
Title: The Bumpy Thread
Post by: Flashy on November 18, 2012, 05:37:28 AM
Quest for bump
Title: The Bumpy Thread
Post by: Spikerocks101 on November 18, 2012, 11:28:26 PM
Bumpquest 2
Title: The Bumpy Thread
Post by: Venera on November 19, 2012, 10:09:17 AM
Bumpquest 3?
Title: The Bumpy Thread
Post by: Spikerocks101 on November 19, 2012, 12:19:00 PM
Bumpquest 3: The Return of Lord Jupitar
Title: The Bumpy Thread
Post by: Venera on November 19, 2012, 01:07:40 PM
The bump lord
Title: The Bumpy Thread
Post by: TH300 on November 19, 2012, 01:54:04 PM
Isn't it supposed to be "Bumppost 2"?
Title: The Bumpy Thread
Post by: Venera on November 19, 2012, 01:57:54 PM
Bumppost 1.5
Title: The Bumpy Thread
Post by: CK9 on November 19, 2012, 04:10:01 PM
Got a flu shot the Friday before last, started having cold symptoms by that Sunday, and got hit so hard last Friday that I was out cold, unresponsive for several hours.  That was bumping miserable, lol

Not as bad as when I got a new flu strain after getting the flu shot, though.
Title: The Bumpy Thread
Post by: Flashy on November 19, 2012, 05:24:56 PM
Bu-ump bumpa bump
Title: The Bumpy Thread
Post by: Venera on November 19, 2012, 09:48:48 PM
that's pretty bumping bad ck9
Title: The Bumpy Thread
Post by: Flashy on November 20, 2012, 11:41:31 AM
I think we already had the dark side of the bump, right?
Title: The Bumpy Thread
Post by: Lukc on November 20, 2012, 12:39:04 PM
Quote
Quote
Hey, Hooman, I noticed. Could you please put back to normal the number of posts per page? 

I have no bumping idea what your talking about. It's always been 25 posts per page!  :whistle:
Of course.

EDIT: No-one is my father.
Title: The Bumpy Thread
Post by: Flashy on November 20, 2012, 06:01:07 PM
Oh, bumping on
Title: The Bumpy Thread
Post by: Spikerocks101 on November 20, 2012, 08:28:25 PM
bubuubmmbmmmbbppbpbpbp
Title: The Bumpy Thread
Post by: CK9 on November 20, 2012, 10:26:26 PM
Wow...8 more pages of bump after this one.  Think we will make it before the new year?  Better yet, before we start seeing stories about people trying to avoid the upcoming disaster of december 21?  Not ot bring a dark tone to the thread, butI wouldn't be surprised if there was a repeat of the Heaven's Gate incident...
Title: The Bumpy Thread
Post by: Hooman on November 21, 2012, 12:12:05 AM
Better yet, do you think you can make it before I up the number of bumps per page again? :P


I recently finished reading "Catch 22". Interesting book.
Oh, and you all have to fly more combat missions before you can go home.
;)
 
Title: The Bumpy Thread
Post by: Spikerocks101 on November 21, 2012, 06:06:31 AM
7 years of bumps. How many more years ahead?
Title: The Bumpy Thread
Post by: Flashy on November 21, 2012, 07:30:00 AM
Sounds like bumpy 7 years. But for now, I'd just say full speed ahead.
Title: The Bumpy Thread
Post by: CK9 on November 21, 2012, 04:08:39 PM
But hooman!  I'm already a bumping ace!
Title: The Bumpy Thread
Post by: Flashy on November 22, 2012, 05:49:43 AM
bumpdings
Title: The Bumpy Thread
Post by: Venera on November 22, 2012, 07:42:50 AM
bump
Title: